Ancestor P1-M45 Defining mutations M242 | Descendants Q1 (L232/S432) | |
Possible time of origin 17,200 to 31,700 years ago (approximately 24,500 years BP) Possible place of origin Central Asia, South Central Siberia) or the Indian subcontinent Highest frequencies Kets, Selkups, Inuit, the indigenous peoples of the Americas, Akha people of northern Thailand, Dayak people of Indonesia, several tribes of Assam and Turkmens |
Haplogroup Q or Q-M242 is a Y-chromosome DNA haplogroup. It has one primary subclade, Haplogroup Q1 (L232/S432), which includes numerous subclades that have been sampled and identified in males among modern populations.
Contents
- Origins
- Technical specification of mutation
- Subclades
- Phylogenetic trees
- The 2015 ISOGG tree
- The Genomic Research Center draft tree
- The Y Chromosome Consortium tree
- Phylogenetic variants
- Americas
- North America
- Mesoamerica South America
- Asia
- North Asia
- East Asia
- Southeast Asia
- Central Asia
- Southwest Asia
- South Asia
- Europe
- Central and Eastern Europe
- Northern Europe
- Western Europe
- Southern Europe
- Africa
- Subclade distribution
- Y DNA Q samples from ancient sites
- References
Q-M242 is the predominant Y-DNA haplogroup among Native Americans and in some regions of Central Asia and Northern Siberia.
Origins
Haplogroup Q-M242 is one of the two branches of P1-M45. (The other is R-M207.)
Q-M242 is believed to have arisen around the Altai Mountains area (or South Central Siberia), approximately 17,000 to 31,700 years ago. However, the matter remains unclear due to limited sample sizes and changing definitions of Haplogroup Q: early definitions used a combination of the SNPs M242, P36.2, and MEH2 as defining mutations.
Karafet et al. (2014), stated: "rapid diversification process of K-M526 likely occurred in Southeast Asia, with subsequent westward expansions of the ancestors of haplogroups R and Q."
Technical specification of mutation
The technical details of M242 are:
Nucleotide change: C to T Position (base pair): 180 Total size (base pairs): 366 Forward 5′→ 3′: aactcttgataaaccgtgctg Reverse 5′→ 3′: tccaatctcaattcatgcctcSubclades
In Y chromosome phylogenetics, subclades are the branches of a haplogroup. These subclades are also defined by single-nucleotide polymorphisms (SNPs) or unique-event polymorphisms (UEPs). Haplogroup Q-M242, according to the most recent available phylogenetics has between 15 and 21 subclades. The scientific understanding of these subclades has changed rapidly. Many key SNPs and corresponding subclades were unknown to researchers at the time of publication are excluded from even recent research. This makes understanding the meaning of individual migration paths challenging.
Phylogenetic trees
There are several confirmed and proposed phylogenetic trees available for haplogroup Q-M242. The scientifically accepted one is the Y Chromosome Consortium (YCC) one published in Karafet 2008 and subsequently updated. A draft tree that shows emerging science is provided by Thomas Krahn at the Genomic Research Center in Houston, Texas. The International Society of Genetic Genealogy (ISOGG) also provides an amateur tree.
The 2015 ISOGG tree
The subclades of Haplogroup Q-M242 with their defining mutation (s), according to the 2015 ISOGG tree are provided below. The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.
The Genomic Research Center draft tree
Below is a 2012 tree by Thomas Krahn of the Genomic Research Center. The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.
The Y Chromosome Consortium tree
This is the 2008 tree produced by the Y Chromosome Consortium (YCC). Subsequent updates have been quarterly and biannual. The current version is a revision of the 2010 update. The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.
Phylogenetic variants
The subclade (under Q-MEH2) proposed by Sharma (2007), which shows polymorphism (ss4bp, rs41352448) at 72,314 position of human arylsulfatase D pseudogene, is not represented in any current trees under Q-MEH2. The most plausible explanation for this could be an ancestral migration of individuals bearing Q-MEH2 to the Indian subcontinent followed by an autochthonous differentiation to Q-ss4bp.
Americas
Several branches of haplogroup Q-M242 have been predominant pre-Columbian male lineages in indigenous peoples of the Americas. Most of them are descendants of the major founding groups who migrated from Asia into the Americas by crossing the Bering Strait. These small groups of founders must have included men from the Q-M346, Q-L54, Q-Z780, and Q-M3 lineages. In the North America, two other Q-lineages also have been found. These are Q-P89.1 (under Q-MEH2) and Q-NWT01. They may have not been from the Beringia Crossings but instead come from later immigrants who traveled along the shoreline of Far East Asia and then the Americas using boats.
It is unclear whether the current frequency of Q-M242 lineages represents their frequency at the time of immigration or is the result of the shifts in a small founder population over time. Anyway, Q-M242 came to dominate the paternal lineages in the Americas.
North America
In the indigenous people of North America, Q-M242 is found in Na-Dené speakers at an average rate of 68%. The highest frequency is 92.3% in Navajo, followed by 78.1% in Apache, 87% in SC Apache, and about 80% in North American Eskimo (Inuit)–Aleut populations. (Q-M3 occupies 46% among Q in North America)
On the other hand, a 4000-year-old Saqqaq individual belonging to Q1a-MEH2* has been found in Greenland. Surprisingly, he was turned out to be generically more closely related to Far East Siberians such as Koryaks and Chukchi people rather than Native Americans. Today, the frequency of Q runs at 53.7% (122/227: 70 Q-NWT01, 52 Q-M3) in Greenland, showing the highest in east Sermersooq at 82% and the lowest in Qeqqata at 30%.
Q-M242 is estimated to occupy 3.1% of the whole US population in 2010: According to the US National Population Census data (2010), the frequency of White people (xHispaic) is 63.7%, followed by Hispanic 16.3%, Black 12.6%, Asian 4.8%, Native American (mainland and Alaska, not including the Pacific islands) 0.9%, etc. And haplogroup Q frequencies in each population sectors are Q-P36* 0.6% & Q-M3 0.1% in White American, Q-P36* 3.8% & Q-M3 7.9% in Hispanic American, Q-P36* (xM3) 0.2% in African American, Q-P36* 31.2% & Q-M3 26.9% in Native American. So, recalculated by the population weights of each sector, the frequency of Q-M242 in the US reaches 3.1% as of 2010. (This figure will rise up, as Hispanic population in the US increases.)
Mesoamerica & South America
Haplogroup Q-M242 has been found in approximately 94% of Indigenous peoples of Mesoamerica and South America. Q-M242 built many ancient cultures and civilizations such as Tiwanaku, Caral(Norte Chico civilization), Maya, Inca, Aztec, and so on.
As a result of five centuries of wide-scale biological mestizaje, or miscegenation, between indigenous Americans and European immigrants, today in Mesoamerica and South America the frequencies of Q-M242 (mostly M3) among the whole male population of each country are lower than indigenous Amerincan populations, but nonetheless run far higher than in the population of North America.
The frequencies of Q among the whole male population (inclusive of all mixed-race and mono-racial groups) of each country reach as follow:
Based on the data above, the average frequency in the whole male population of Mesoamerica and South America is estimated to be about 18%.
Asia
Q-M242 originated in Asia (Altai regions), and is widely distributed across it. Q-M242 is found in Russia, Siberia (Kets, Selkups, Siberian Yupik people, Nivkhs, Chukchi people, Yukaghirs, Tuvans, Altai people, Koryaks, etc.), Mongolia, China, Uyghurs, Tibet, Korea, Japan, Indonesia, Vietnam, Thailand, India, Pakistan, Afghanistan, Iran, Iraq, Saudi Arabia, Turkmenistan, Uzbekistan, and so on. (For details, see below.)
North Asia
In Siberia, the regions between Altai and Lake Baikal, which are famous for many prehistoric cultures and as the most likely birthplace of haplogroup Q, exhibit high frequencies of Q-M242. In a study (Dulik 2012), Q-M242 (mostly Q-M346 including some Q-M3) has been found in 24.3% (46/189: 45 Q-M346, 1 Q-M25) of all Altaian samples. Among them, Chelkans show the highest frequency at 60.0% (15/25: all Q-M346), followed by Tubalars at 41% (11/27: 1 Q-M25, 10 Q-M346) and Altaians-Kizhi at 17% (20/120). In a former study, Q-M242 is found in 4.2% of southern Altaians and 32.0% of northern Altaians with the highest frequency of 63.6% in Kurmach-Baigol (Baygol). The frequency reaches 13.7% (20/146) in the whole samples. In another study, the frequency rises up to 25.8% (23/89: all Q-M346) in Altaians. Based on the results of these studies, the average frequency of Q-M242 in Altaians is about 21%.
Tuva, which is located on the east side of Altai Republic and west of Lake Baikal as well as on the north side of Mongolia, shows higher frequency of Q-M242. It is found in 16%~38.0% (41/108) of Tuvans. Also, Todjins (Tozhu Tuvans) in eastern Tuva shows the frequency at 38.5% (10/26, all Q-M346). So, the average frequency of Q-M242 in Tuva is about 31%.
The highest frequencies of Q-M242 in Eurasia are witnessed in Kets (central Siberia) at 93.8% (45/48) and in Selkups (north Siberia) at 66.4% (87/131). Russian ethnographers believe that their ancient places were farther south, in the area of the Altai and Sayan Mountains (Altai-Sayan region). Their populations are currently small in number, being just under 1,500 and 5,000 respectively. In linguistic anthropology, the Ket language is significant as it is currently the only surviving one in the Yeniseian language family which has been linked by some scholars to the Native American Na-Dené languages and, more controversially, the language of the Huns. (See: L. Lieti, E. Pulleybank, E. Vajda, A. Vovin, etc.) Q-M346 is also found at lower rates in Sojots (7.1%, Q-M346), Khakassians (6.3%, Q-M346), Kalmyks (3.4%, Q-M25, Q-M346) and Khanty, and so on.
In far eastern Siberia, Q-M242 is found in 35.3% of Nivkhs (Gilyaks) in the lower Amur River, and 33.3% of Chukchi people and 39.2% of Siberian Yupik people in Chukotka (Chukchi Peninsula). It is found in 30.8% of Yukaghirs who live in the basin of the Kolyma River, which is located northwest of Kamchatka. It is also found in 15% (Q1a* 9%, Q-M3 6%) of Koryaks in Kamchatka.
East Asia
In some studies, various subgroups of Q-M242 are observed in Mongolia. Q1a2-M346 (mostly Q-L330) occupies 1.4~3.1% of Mongols (1/2~2/3 among Q samples), followed by Q1a1a1-M120 (0.25~1.25%), Q1a1b-M25 (0.25~0.63%), Q1b-M378. In another study, Q is found in 4% of Mongols. Based on these studies, the average frequency of Q-M242 in Mongols is estimated to be about 4~5%.
However, most of Q-M242 people in East Asia belong to subclade Q-M120, which distributes most intensively across northern China (the provinces of which the capitals locate northern to Huai River-Qin Mountains line). Q-M242 ranged from 4~8% in northwest China (Xinjiang, Gansu, Shaanxi), north China (Shanxi, Hebei), central China (Henan), and upper east China (Shandong) to 3~4% in northeast China (Manchuria). The average frequency of Q-M242 in northern China is around 4.5%. However, it decreases to about 2% in southern China. In a study published in 2011, researchers have found Q-M242 in 3.3% (12/361) of the samples of unrelated Han-Chinese male volunteers at Fudan University in Shanghai with the origins from all over China, though with the majority coming from east China.
Q-M242 is found in about 9.5% of Uyghurs, with Q-M346 occupying the half and followed by Q1*, Q-M120, Q-M378, Q-M25. It is also found in approximately 3.2% (5/156 : 2 Q-M120, 3 Q-M346) of males in Tibet.
It is found in about 1.9% of South Koreans, showing the highest frequency in Seoul and Gyeonggi Province at 2.7% and decreasing ones to the south (Kim 2010). It is about in 0.5% of Japanese and in 0.3%~1.2% of Taiwanese.
Subclade Q1b-M378 is also found in China and its neighboring countries at very low frequencies. It exists throughout all Mongolia, with rare examples in Japan.
Southeast Asia
Haplogroup Q shows low frequencies in Southeast Asia. In a study, the frequencies of haplogroup Q is 5.4% (2/37) in Indonesia, 3.1% (2/64) in the Philippines, 2.5% (1/40) in Thailand. However, other studies show 0% or near 0% frequencies in those countries. In the case of Vietnam, the frequency is 7% in a study, but 0% or under 1% in other studies. So, it is hard to define average frequencies. But, it is safe to say that southeast Asia generally shows very low frequency (about 0.5%~1%) of Q-M242, and the continental regions show higher frequencies than island ones.
Only some regions and ethnic groups in the continent show high frequencies. Q-M242 is found in 2.8% (3/106, all Q-M346) in Myanmar, and all the Q samples are concentrated in Ayeyarwady (2/11) and Bago (1/14) regions in southwest Myanmar. And, Q-M242 is found in 55.6% (15/27) in the Akha tribe in northern Thailand. The Akha are known to have moved from southern China (east Tibet and Yunnan) to Southeast Asia over the past centuries, and to have originated from a northern area such as Mongolia or Manchuria a long time ago.
Central Asia
In Central Asia, the southern regions show higher frequencies of Q than the northern ones.
In the northern regions, Q-M242 is found in about 2%~6% (average 4%) of Kazakhs. It is found in about 2% of Kyrgyz people.
In the southern regions, Q-M242 is found in 5%~6% of Tajiks (Tajikistan), and in about 8.3% of Uzbeks In case of Turkmenistan, the frequency is not clear, but it can reach about 40% in light of the frequencies (34%~43%) in Turkmens of Afghanistan and Iran who live in the areas adjacent to Turkmenistan.
Southwest Asia
Southwest Asia exhibits high frequencies of Q in northern Iran, and gradually lowering ones to the southwest.
Q-M242 accounts for 5.5% (52/938) in Iran according to Grugni 2012, which shows a large and well allocated sampling. The Q samples (52) in the study consist of various subclades such as Q* (3), Q-M120 (1), Q-M25 (30), Q-M346 (8), Q-M378 (10). The highest frequency is at 42.6% (29/68, all Q-M25) in Turkmens of Golestan, followed by 9.1% in Isfahan (Persian people), 6.8% in Khorasan (Persian people), 6% in Lorestan (Luristan, Lurs), 4.9% in Azarbaijan Gharbi (5.1% of Assyrians and 4.8% of Azeris), 4.5% in Fars (Persian people), and so on. Turkmens are known as the descendants of Oghuz Turks who built many Turkic empires and dynasties. Other studies also show similar frequencies.
In a study (Zahery 2011), the frequency of Q is 1.9% (3/154: all Q-M378) in Iraqis (x Marsh Arabs), and 2.8% (4/143: 1 Q-M25, 3 Q-M378) in Marsh Arabs who are known as the descendants of ancient Sumerians. So, there have been many controversies over the connections between Sumerians and ancient Bolivian (and Peruvian) cultures.
Approximately 2.5% (4/157: 3 Q*, 1 Q-M346) of males in Saudi Arabia belong to haplogroup Q. It also accounts for 1.8% (3/164: 2 Q*, 1 Q-M346) in the United Arab Emirates and 0.8% (1/121: Q*) in Oman peoples.
Haplogroup Q-M242 has also been found in 1.1% (1/87, Q-P36) Syrians and 2.0% (18/914, 14 Q*, 4 Q-M25) in Lebanese.
Approximately 2% (10/523: 9 Q*, 1 Q-M25) of males in Turkey belong to haplogroup Q. In a study (Gokcumen 2008), it was found that among Turks who belong to the Afshar tribe (one of Oghuz Turks) haplogroup Q-M242 is seen with a prevalence of 13%.
South Asia
Q-M242 accounts for 6.9% of Afghans in a study (Haber 2012). In this study, 18.4% (9/49: 8 Q*, 1 Q-M346) of Pashtuns, the largest ethnic group in Afghanistan, turned out to be haplogroup Q. In another study (Cristofaro 2013) with a large sampling, the frequency of Q rises to 8.9% (45/507). In this study, Turkmens of Jowzjan Province which is neighboring to Turkmenistan show the highest frequency at 33.8% (25/74: 23 Q-M25, 2 Q-M346), followed by Uzbeks at 8.7% (11/144: 6 Q*, 1 Q-M25, 4 Q-M346). If the results of these studies are aggregated and recalculated by population weights of each ethnic group, the frequency of Q in Afghan males will be 6.3%.
In Pakistan at the eastern end of the Iranian Plateau, the frequency of haplogroup Q-M242 is about 2.2% (14/638)~3.4% (6/176).
In a study (Sharma2007), Q-M242 is observed in 2.38% (15/630) of Indian people belonging to different regions and social categories. What is interesting is 14/15 samples do not belong to any known subgroups of Q-M242, with 4 among them showing novel (Indian-specific) ‘ss4bp’ allele under Q-MEH2. This study also reflects the results of some former studies (Sengupta 2006, Seielstad 2003). And, the accumulated result (frequency) of 3 studies is turned out to be 1.3% (21/1615), with 11 out of 21 Q samples ranked as high caste in social category. (For more information, see Y-DNA haplogroups in populations of South Asia)
In another regional studies on India, Q-M242 is found in 2.8% (8/284, all Q-M346) of Gujarat (Western India) people and in 6.1% (3/49) of Hindus in New Delhi, the capital of India.
1.2% of Nepalese people in Kathmandu, the capital of Nepal, are in Q-M242.
In a study in which Q-M242 is just classified in P* group, P* (x R1, R2) accounts for 9.7% (23/237: Chakma 13/89, Marma 4/60, Tripura 6/88) in three ethnic groups of Bangladesh. In many cases, all or most of P* (x R1, R2) means Q-M242, and thus most of P* (9.7%) samples in that study can be estimated to be Q-M242.
3.3% of Sri Lankans are also in Q-M242.
Europe
Q-M242 is distributed across most European countries at low frequencies, and the frequencies decrease to the west and to the south.
Central- and Eastern Europe
In Central- Eastern Europe, Q-M242 comprises about 1.7% of males. Q-M242 is found in about 2% of Russians, 1.5% of Belarusians, 1.3% of Ukrainians 0.5 1.3% of Poles (Poland), 2% of Czechs, 1.5% of Slovaks, about 2.2% of Hungarians, 1.2% of Romanians, 0.8% of Moldovans, and 0.5% (4/808: 2 Q-M378, 1 Q-M346, 1 Q-M25) of Bulgarians On the other hand, 3.1% of Székelys from Transylvania (who have claimed to be descendants of Attila’s Huns) turned out to be P* (xR1-M173), which virtually means Q-M242. In a related DNA Project of FT-DNA, the frequency of Q-M25 in Székelys (Szeklers) reaches 4.3%.
The Caucasus region shows a frequency at 1.2% in a study, but it may reach over 4% in Azerbaijan, in that 4.9% of the neighboring Iranian Azerbaijanis harbor Q-M242. It is 1.3% in Georgians and Armenians respectively, and Armenian subclades consist of Q-M378 (L245), Q-M346, and Q-M25.
Northern Europe
In Northern Europe, haplogroup Q comprises about 2.5% of males. According to the Swedish Haplogroup Database, 4.1% (27/664, as of Jan 2016) of Swedish males belong to Q-M242. About 2/3 of the samples analyzed subclades in detail belong to Q1a2b-F1161/L527 and about 1/3 are in Q1a2a-L804. By county, they are distributed intensively in the southern region (Götaland,: not to be confused with Gotland), and rarely to the north. The highest frequency of Q is shown at 20% in Halland County, followed by 14.3% in Jönköping, 12.5% in Kronoberg County, 12.5% in Västmanland, 8.7% in Gävleborg County, 4.3% in Västra Götaland County, 4% in Stockholm, 3.9% in Skåne County(Scania), and so on. If recalculated by county-population weights, the frequency of Q in Sweden reaches 4.7%.
In Norway, Q-M242 is found in about 2.6% (~4%) of males, with Q-L804 being more common than Q-F1161/L527. It is observed among 1.6% of males in Denmark, 3% in the Faroe Islands (known to be related to Vikings). In an article (Helgason et al.) on the haplotypes of Icelanders, 7.2% (13/181) of males in Iceland are labelled as R1b-Branch A, but they are actually Q-M242. On the other hand, it is 0.2% in Finland, 4.6% in Latvia, 1.1% in Lithuania, 0.5% in Estonia.
Western Europe
In Western Europe, Q-M242 is observed at very low frequencies, around 0.5% in most of the countries, such as Germany, France, United Kingdom, etc., but some regions show a little higher. It is 2.1% in Switzerland, and it reaches 5.1% in Lyon (Rhône-Alpes) region of France. It is about 4% in Shetland of northernmost Britain, with a place in it showing the highest figure at 8%. Shetland has been known to be a settlement of Vikings. And, surprisingly, Q-M242 in Shetland (also in some areas of Scandinavia, Faroe Islands, Iceland, and the Great United Kingdom) has turned out to be generically closely linked to the Q-M242 in Central Asia, . Also, Shetland (Norse) Q-M242 is revealed to be linked to some Q-M242 of Azeris (Azerbaijan).
Southern Europe
Southern Europe also shows low frequencies of Q around 0.5%~1%, but some regions exhibits different figures. It is 1.9% in mainland Croatia, but it reaches 14.3% (13/91) in Hvar Islands and 6.1% (8/132) in Korčula. Also, it is about 0.6% in Italy, but it rises to 2.5% (6/236) in Sicily, where it reaches 16.7% (3/18) in Mazara del Vallo region, followed by 7.1% (2/28) in Ragusa, 3.6% in Sciacca, and 3.7% in Belvedere Marittimo.
On the other hand, according to a study (Behar 2004), 5.2% (23/441) of Ashkenazi Jews males belong to haplogroup Q-P36. This has subsequently been found to be entirely the Q-M378 subclade and may be restricted to Q-L245. Also, 2.3% (4/174)~5.6% (3/53) of Sephardi Jews are in haplogroup Q.
Africa
Haplogroup Q is rarely found across North Africa. It is observed in 0.7% (1/147), of Egyptians and in 0.6% (1/156) of Algerian people. Surprisingly, it is also witnessed in 0.8% (3/381, all Q-M346) of males from Comoros which is located in between East Africa and Madagascar.
To combine the data above, Q-M242 is estimated to be in about 3.1% of males of the world.