Kalpana Kalpana (Editor)

Haplogroup Q M242

Updated on
Edit
Like
Comment
Share on FacebookTweet on TwitterShare on LinkedInShare on Reddit
Ancestor
  
P1-M45

Defining mutations
  
M242

Descendants
  
Q1 (L232/S432)

Haplogroup Q-M242

Possible time of origin
  
17,200 to 31,700 years ago (approximately 24,500 years BP)

Possible place of origin
  
Central Asia, South Central Siberia) or the Indian subcontinent

Highest frequencies
  
Kets, Selkups, Inuit, the indigenous peoples of the Americas, Akha people of northern Thailand, Dayak people of Indonesia, several tribes of Assam and Turkmens

Origins

Haplogroup Q-M242 is one of the two branches of P1-M45. (The other is R-M207.)

Q-M242 is believed to have arisen around the Altai Mountains area (or South Central Siberia), approximately 17,000 to 31,700 years ago. However, the matter remains unclear due to limited sample sizes and changing definitions of Haplogroup Q: early definitions used a combination of the SNPs M242, P36.2, and MEH2 as defining mutations.

Karafet et al. (2014), stated: "rapid diversification process of K-M526 likely occurred in Southeast Asia, with subsequent westward expansions of the ancestors of haplogroups R and Q."

Technical specification of mutation

The technical details of M242 are:

Nucleotide change: C to TPosition (base pair): 180Total size (base pairs): 366Forward 5′→ 3′: aactcttgataaaccgtgctgReverse 5′→ 3′: tccaatctcaattcatgcctc

Subclades

In Y chromosome phylogenetics, subclades are the branches of a haplogroup. These subclades are also defined by single-nucleotide polymorphisms (SNPs) or unique-event polymorphisms (UEPs). Haplogroup Q-M242, according to the most recent available phylogenetics has between 15 and 21 subclades. The scientific understanding of these subclades has changed rapidly. Many key SNPs and corresponding subclades were unknown to researchers at the time of publication are excluded from even recent research. This makes understanding the meaning of individual migration paths challenging.

Phylogenetic trees

There are several confirmed and proposed phylogenetic trees available for haplogroup Q-M242. The scientifically accepted one is the Y Chromosome Consortium (YCC) one published in Karafet 2008 and subsequently updated. A draft tree that shows emerging science is provided by Thomas Krahn at the Genomic Research Center in Houston, Texas. The International Society of Genetic Genealogy (ISOGG) also provides an amateur tree.

The 2015 ISOGG tree

The subclades of Haplogroup Q-M242 with their defining mutation (s), according to the 2015 ISOGG tree are provided below. The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.

  • Q-M242 M242
  • Q-P36.2 P36.2, L232, L273, L274 (Q1)
  • Q-MEH2 MEH2 (Q1a)
  • Q-F1096 F1096, F1215 (Q1a1)
  • Q-NWT01 NWT01 (Q1a1a)
  • Q-M120 M120, M265/N14 (Q1a1a1)
  • Q-M25 M25, M143 (Q1a1b)
  • Q-L712 L712 (Q1a1b1)
  • Q-M346 L56, L57, M346, L528 (Q1a2)
  • Q-L53 L53 (Q1a2a)
  • Q-L54 L54 (Q1a2a1)
  • Q-CTS11969 CTS11969, M930 (Q1a2a1a)
  • Q-M3 M3 (Q1a2a1a1)
  • Q-M19 M19 (Q1a2a1a1a)
  • Q-L804 L804 (Q1a2a1a2)
  • Q-CTS1780 CTS1780, M981, M971, Z780 (Q1a2a1b)
  • Q-L330 L330 (Q1a2a1c)
  • Q-F835 F835, L940 (Q1a2b)
  • Q-F1161 F1161
  • Q-L527 L527
  • Q-L275 L275, L314 (Q1b)
  • Q-M378 M378/Page100, L214, L215/Page82 (Q1b1)
  • Q-FGC1774 FGC1774, Y2016 (Q1b1a)
  • Q-245 L245 (Q1b1a1)
  • Q-Y1150 Y1150 (Q1b2) (Q1b-L68)
  • The Genomic Research Center draft tree

    Below is a 2012 tree by Thomas Krahn of the Genomic Research Center. The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.

  • P-M45
  • Q-M242 M242
  • P36.2, L232, L273.1, L274.1
  • MEH2, L472, L528
  • M120, N14/M265
  • M25, M143, L714, L716
  • M346, L56, L57, L474, L892, L942
  • P89.1
  • NWT01
  • L275, L314, L606, L612
  • M378, L214, L215
  • The Y Chromosome Consortium tree

    This is the 2008 tree produced by the Y Chromosome Consortium (YCC). Subsequent updates have been quarterly and biannual. The current version is a revision of the 2010 update. The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.

  • P-M45
  • Q-M242 M242
  • Q-P36.2 P36.2
  • Q-MEH2 MEH2
  • Q-M120 M120, N14, M265
  • Q-M25 M25, M143
  • Q-M346 L56, L57, M346
  • Q-P89.1 P89.1
  • Q-L275 L275
  • Q-M378 L214, L215, M378
  • Phylogenetic variants

    The subclade (under Q-MEH2) proposed by Sharma (2007), which shows polymorphism (ss4bp, rs41352448) at 72,314 position of human arylsulfatase D pseudogene, is not represented in any current trees under Q-MEH2. The most plausible explanation for this could be an ancestral migration of individuals bearing Q-MEH2 to the Indian subcontinent followed by an autochthonous differentiation to Q-ss4bp.

    Americas

    Several branches of haplogroup Q-M242 have been predominant pre-Columbian male lineages in indigenous peoples of the Americas. Most of them are descendants of the major founding groups who migrated from Asia into the Americas by crossing the Bering Strait. These small groups of founders must have included men from the Q-M346, Q-L54, Q-Z780, and Q-M3 lineages. In the North America, two other Q-lineages also have been found. These are Q-P89.1 (under Q-MEH2) and Q-NWT01. They may have not been from the Beringia Crossings but instead come from later immigrants who traveled along the shoreline of Far East Asia and then the Americas using boats.

    It is unclear whether the current frequency of Q-M242 lineages represents their frequency at the time of immigration or is the result of the shifts in a small founder population over time. Anyway, Q-M242 came to dominate the paternal lineages in the Americas.

    North America

    In the indigenous people of North America, Q-M242 is found in Na-Dené speakers at an average rate of 68%. The highest frequency is 92.3% in Navajo, followed by 78.1% in Apache, 87% in SC Apache, and about 80% in North American Eskimo (Inuit)–Aleut populations. (Q-M3 occupies 46% among Q in North America)

    On the other hand, a 4000-year-old Saqqaq individual belonging to Q1a-MEH2* has been found in Greenland. Surprisingly, he was turned out to be generically more closely related to Far East Siberians such as Koryaks and Chukchi people rather than Native Americans. Today, the frequency of Q runs at 53.7% (122/227: 70 Q-NWT01, 52 Q-M3) in Greenland, showing the highest in east Sermersooq at 82% and the lowest in Qeqqata at 30%.

    Q-M242 is estimated to occupy 3.1% of the whole US population in 2010: According to the US National Population Census data (2010), the frequency of White people (xHispaic) is 63.7%, followed by Hispanic 16.3%, Black 12.6%, Asian 4.8%, Native American (mainland and Alaska, not including the Pacific islands) 0.9%, etc. And haplogroup Q frequencies in each population sectors are Q-P36* 0.6% & Q-M3 0.1% in White American, Q-P36* 3.8% & Q-M3 7.9% in Hispanic American, Q-P36* (xM3) 0.2% in African American, Q-P36* 31.2% & Q-M3 26.9% in Native American. So, recalculated by the population weights of each sector, the frequency of Q-M242 in the US reaches 3.1% as of 2010. (This figure will rise up, as Hispanic population in the US increases.)

    Mesoamerica & South America

    Haplogroup Q-M242 has been found in approximately 94% of Indigenous peoples of Mesoamerica and South America. Q-M242 built many ancient cultures and civilizations such as Tiwanaku, Caral(Norte Chico civilization), Maya, Inca, Aztec, and so on.

    As a result of five centuries of wide-scale biological mestizaje, or miscegenation, between indigenous Americans and European immigrants, today in Mesoamerica and South America the frequencies of Q-M242 (mostly M3) among the whole male population of each country are lower than indigenous Amerincan populations, but nonetheless run far higher than in the population of North America.

    The frequencies of Q among the whole male population (inclusive of all mixed-race and mono-racial groups) of each country reach as follow:

  • 61% in Bolivia.
  • 51% in Guatemala,
  • 40.1% (159/397) to 50% in Peru
  • 37.6% in Ecuador,
  • 37.3% (181/485) in Mexico (30.8% (203/659) among the specifically Mestizo segment)
  • 31.2% (50/160) in El Salvador,
  • 15.3% (37/242) to 21.8% (89/408) in Panama,
  • 16.1% in Colombia,
  • 15.2% (25/165) in Nicaragua,
  • 9.7% (20/206) in Chile,
  • 5.3% (13/246 in 8 provinces in northeastern, central, southern regions) to 23.4% (181/775 in 8 provinces in central-west, central, northwest regions) in Argentina,
  • 5% in Costa Rica,
  • 3.95% in Brazil, and so on.
  • Based on the data above, the average frequency in the whole male population of Mesoamerica and South America is estimated to be about 18%.

    Asia

    Q-M242 originated in Asia (Altai regions), and is widely distributed across it. Q-M242 is found in Russia, Siberia (Kets, Selkups, Siberian Yupik people, Nivkhs, Chukchi people, Yukaghirs, Tuvans, Altai people, Koryaks, etc.), Mongolia, China, Uyghurs, Tibet, Korea, Japan, Indonesia, Vietnam, Thailand, India, Pakistan, Afghanistan, Iran, Iraq, Saudi Arabia, Turkmenistan, Uzbekistan, and so on. (For details, see below.)

    North Asia

    In Siberia, the regions between Altai and Lake Baikal, which are famous for many prehistoric cultures and as the most likely birthplace of haplogroup Q, exhibit high frequencies of Q-M242. In a study (Dulik 2012), Q-M242 (mostly Q-M346 including some Q-M3) has been found in 24.3% (46/189: 45 Q-M346, 1 Q-M25) of all Altaian samples. Among them, Chelkans show the highest frequency at 60.0% (15/25: all Q-M346), followed by Tubalars at 41% (11/27: 1 Q-M25, 10 Q-M346) and Altaians-Kizhi at 17% (20/120). In a former study, Q-M242 is found in 4.2% of southern Altaians and 32.0% of northern Altaians with the highest frequency of 63.6% in Kurmach-Baigol (Baygol). The frequency reaches 13.7% (20/146) in the whole samples. In another study, the frequency rises up to 25.8% (23/89: all Q-M346) in Altaians. Based on the results of these studies, the average frequency of Q-M242 in Altaians is about 21%.

    Tuva, which is located on the east side of Altai Republic and west of Lake Baikal as well as on the north side of Mongolia, shows higher frequency of Q-M242. It is found in 16%~38.0% (41/108) of Tuvans. Also, Todjins (Tozhu Tuvans) in eastern Tuva shows the frequency at 38.5% (10/26, all Q-M346). So, the average frequency of Q-M242 in Tuva is about 31%.

    The highest frequencies of Q-M242 in Eurasia are witnessed in Kets (central Siberia) at 93.8% (45/48) and in Selkups (north Siberia) at 66.4% (87/131). Russian ethnographers believe that their ancient places were farther south, in the area of the Altai and Sayan Mountains (Altai-Sayan region). Their populations are currently small in number, being just under 1,500 and 5,000 respectively. In linguistic anthropology, the Ket language is significant as it is currently the only surviving one in the Yeniseian language family which has been linked by some scholars to the Native American Na-Dené languages and, more controversially, the language of the Huns. (See: L. Lieti, E. Pulleybank, E. Vajda, A. Vovin, etc.) Q-M346 is also found at lower rates in Sojots (7.1%, Q-M346), Khakassians (6.3%, Q-M346), Kalmyks (3.4%, Q-M25, Q-M346) and Khanty, and so on.

    In far eastern Siberia, Q-M242 is found in 35.3% of Nivkhs (Gilyaks) in the lower Amur River, and 33.3% of Chukchi people and 39.2% of Siberian Yupik people in Chukotka (Chukchi Peninsula). It is found in 30.8% of Yukaghirs who live in the basin of the Kolyma River, which is located northwest of Kamchatka. It is also found in 15% (Q1a* 9%, Q-M3 6%) of Koryaks in Kamchatka.

    East Asia

    In some studies, various subgroups of Q-M242 are observed in Mongolia. Q1a2-M346 (mostly Q-L330) occupies 1.4~3.1% of Mongols (1/2~2/3 among Q samples), followed by Q1a1a1-M120 (0.25~1.25%), Q1a1b-M25 (0.25~0.63%), Q1b-M378. In another study, Q is found in 4% of Mongols. Based on these studies, the average frequency of Q-M242 in Mongols is estimated to be about 4~5%.

    However, most of Q-M242 people in East Asia belong to subclade Q-M120, which distributes most intensively across northern China (the provinces of which the capitals locate northern to Huai River-Qin Mountains line). Q-M242 ranged from 4~8% in northwest China (Xinjiang, Gansu, Shaanxi), north China (Shanxi, Hebei), central China (Henan), and upper east China (Shandong) to 3~4% in northeast China (Manchuria). The average frequency of Q-M242 in northern China is around 4.5%. However, it decreases to about 2% in southern China. In a study published in 2011, researchers have found Q-M242 in 3.3% (12/361) of the samples of unrelated Han-Chinese male volunteers at Fudan University in Shanghai with the origins from all over China, though with the majority coming from east China.

    Q-M242 is found in about 9.5% of Uyghurs, with Q-M346 occupying the half and followed by Q1*, Q-M120, Q-M378, Q-M25. It is also found in approximately 3.2% (5/156 : 2 Q-M120, 3 Q-M346) of males in Tibet.

    It is found in about 1.9% of South Koreans, showing the highest frequency in Seoul and Gyeonggi Province at 2.7% and decreasing ones to the south (Kim 2010). It is about in 0.5% of Japanese and in 0.3%~1.2% of Taiwanese.

    Subclade Q1b-M378 is also found in China and its neighboring countries at very low frequencies. It exists throughout all Mongolia, with rare examples in Japan.

    Southeast Asia

    Haplogroup Q shows low frequencies in Southeast Asia. In a study, the frequencies of haplogroup Q is 5.4% (2/37) in Indonesia, 3.1% (2/64) in the Philippines, 2.5% (1/40) in Thailand. However, other studies show 0% or near 0% frequencies in those countries. In the case of Vietnam, the frequency is 7% in a study, but 0% or under 1% in other studies. So, it is hard to define average frequencies. But, it is safe to say that southeast Asia generally shows very low frequency (about 0.5%~1%) of Q-M242, and the continental regions show higher frequencies than island ones.

    Only some regions and ethnic groups in the continent show high frequencies. Q-M242 is found in 2.8% (3/106, all Q-M346) in Myanmar, and all the Q samples are concentrated in Ayeyarwady (2/11) and Bago (1/14) regions in southwest Myanmar. And, Q-M242 is found in 55.6% (15/27) in the Akha tribe in northern Thailand. The Akha are known to have moved from southern China (east Tibet and Yunnan) to Southeast Asia over the past centuries, and to have originated from a northern area such as Mongolia or Manchuria a long time ago.

    Central Asia

    In Central Asia, the southern regions show higher frequencies of Q than the northern ones.

    In the northern regions, Q-M242 is found in about 2%~6% (average 4%) of Kazakhs. It is found in about 2% of Kyrgyz people.

    In the southern regions, Q-M242 is found in 5%~6% of Tajiks (Tajikistan), and in about 8.3% of Uzbeks In case of Turkmenistan, the frequency is not clear, but it can reach about 40% in light of the frequencies (34%~43%) in Turkmens of Afghanistan and Iran who live in the areas adjacent to Turkmenistan.

    Southwest Asia

    Southwest Asia exhibits high frequencies of Q in northern Iran, and gradually lowering ones to the southwest.

    Q-M242 accounts for 5.5% (52/938) in Iran according to Grugni 2012, which shows a large and well allocated sampling. The Q samples (52) in the study consist of various subclades such as Q* (3), Q-M120 (1), Q-M25 (30), Q-M346 (8), Q-M378 (10). The highest frequency is at 42.6% (29/68, all Q-M25) in Turkmens of Golestan, followed by 9.1% in Isfahan (Persian people), 6.8% in Khorasan (Persian people), 6% in Lorestan (Luristan, Lurs), 4.9% in Azarbaijan Gharbi (5.1% of Assyrians and 4.8% of Azeris), 4.5% in Fars (Persian people), and so on. Turkmens are known as the descendants of Oghuz Turks who built many Turkic empires and dynasties. Other studies also show similar frequencies.

    In a study (Zahery 2011), the frequency of Q is 1.9% (3/154: all Q-M378) in Iraqis (x Marsh Arabs), and 2.8% (4/143: 1 Q-M25, 3 Q-M378) in Marsh Arabs who are known as the descendants of ancient Sumerians. So, there have been many controversies over the connections between Sumerians and ancient Bolivian (and Peruvian) cultures.

    Approximately 2.5% (4/157: 3 Q*, 1 Q-M346) of males in Saudi Arabia belong to haplogroup Q. It also accounts for 1.8% (3/164: 2 Q*, 1 Q-M346) in the United Arab Emirates and 0.8% (1/121: Q*) in Oman peoples.

    Haplogroup Q-M242 has also been found in 1.1% (1/87, Q-P36) Syrians and 2.0% (18/914, 14 Q*, 4 Q-M25) in Lebanese.

    Approximately 2% (10/523: 9 Q*, 1 Q-M25) of males in Turkey belong to haplogroup Q. In a study (Gokcumen 2008), it was found that among Turks who belong to the Afshar tribe (one of Oghuz Turks) haplogroup Q-M242 is seen with a prevalence of 13%.

    South Asia

    Q-M242 accounts for 6.9% of Afghans in a study (Haber 2012). In this study, 18.4% (9/49: 8 Q*, 1 Q-M346) of Pashtuns, the largest ethnic group in Afghanistan, turned out to be haplogroup Q. In another study (Cristofaro 2013) with a large sampling, the frequency of Q rises to 8.9% (45/507). In this study, Turkmens of Jowzjan Province which is neighboring to Turkmenistan show the highest frequency at 33.8% (25/74: 23 Q-M25, 2 Q-M346), followed by Uzbeks at 8.7% (11/144: 6 Q*, 1 Q-M25, 4 Q-M346). If the results of these studies are aggregated and recalculated by population weights of each ethnic group, the frequency of Q in Afghan males will be 6.3%.

    In Pakistan at the eastern end of the Iranian Plateau, the frequency of haplogroup Q-M242 is about 2.2% (14/638)~3.4% (6/176).

    In a study (Sharma2007), Q-M242 is observed in 2.38% (15/630) of Indian people belonging to different regions and social categories. What is interesting is 14/15 samples do not belong to any known subgroups of Q-M242, with 4 among them showing novel (Indian-specific) ‘ss4bp’ allele under Q-MEH2. This study also reflects the results of some former studies (Sengupta 2006, Seielstad 2003). And, the accumulated result (frequency) of 3 studies is turned out to be 1.3% (21/1615), with 11 out of 21 Q samples ranked as high caste in social category. (For more information, see Y-DNA haplogroups in populations of South Asia)

    In another regional studies on India, Q-M242 is found in 2.8% (8/284, all Q-M346) of Gujarat (Western India) people and in 6.1% (3/49) of Hindus in New Delhi, the capital of India.

    1.2% of Nepalese people in Kathmandu, the capital of Nepal, are in Q-M242.

    In a study in which Q-M242 is just classified in P* group, P* (x R1, R2) accounts for 9.7% (23/237: Chakma 13/89, Marma 4/60, Tripura 6/88) in three ethnic groups of Bangladesh. In many cases, all or most of P* (x R1, R2) means Q-M242, and thus most of P* (9.7%) samples in that study can be estimated to be Q-M242.

    3.3% of Sri Lankans are also in Q-M242.

    Europe

    Q-M242 is distributed across most European countries at low frequencies, and the frequencies decrease to the west and to the south.

    Central- and Eastern Europe

    In Central- Eastern Europe, Q-M242 comprises about 1.7% of males. Q-M242 is found in about 2% of Russians, 1.5% of Belarusians, 1.3% of Ukrainians 0.5 1.3% of Poles (Poland), 2% of Czechs, 1.5% of Slovaks, about 2.2% of Hungarians, 1.2% of Romanians, 0.8% of Moldovans, and 0.5% (4/808: 2 Q-M378, 1 Q-M346, 1 Q-M25) of Bulgarians On the other hand, 3.1% of Székelys from Transylvania (who have claimed to be descendants of Attila’s Huns) turned out to be P* (xR1-M173), which virtually means Q-M242. In a related DNA Project of FT-DNA, the frequency of Q-M25 in Székelys (Szeklers) reaches 4.3%.

    The Caucasus region shows a frequency at 1.2% in a study, but it may reach over 4% in Azerbaijan, in that 4.9% of the neighboring Iranian Azerbaijanis harbor Q-M242. It is 1.3% in Georgians and Armenians respectively, and Armenian subclades consist of Q-M378 (L245), Q-M346, and Q-M25.

    Northern Europe

    In Northern Europe, haplogroup Q comprises about 2.5% of males. According to the Swedish Haplogroup Database, 4.1% (27/664, as of Jan 2016) of Swedish males belong to Q-M242. About 2/3 of the samples analyzed subclades in detail belong to Q1a2b-F1161/L527 and about 1/3 are in Q1a2a-L804. By county, they are distributed intensively in the southern region (Götaland,: not to be confused with Gotland), and rarely to the north. The highest frequency of Q is shown at 20% in Halland County, followed by 14.3% in Jönköping, 12.5% in Kronoberg County, 12.5% in Västmanland, 8.7% in Gävleborg County, 4.3% in Västra Götaland County, 4% in Stockholm, 3.9% in Skåne County(Scania), and so on. If recalculated by county-population weights, the frequency of Q in Sweden reaches 4.7%.

    In Norway, Q-M242 is found in about 2.6% (~4%) of males, with Q-L804 being more common than Q-F1161/L527. It is observed among 1.6% of males in Denmark, 3% in the Faroe Islands (known to be related to Vikings). In an article (Helgason et al.) on the haplotypes of Icelanders, 7.2% (13/181) of males in Iceland are labelled as R1b-Branch A, but they are actually Q-M242. On the other hand, it is 0.2% in Finland, 4.6% in Latvia, 1.1% in Lithuania, 0.5% in Estonia.

    Western Europe

    In Western Europe, Q-M242 is observed at very low frequencies, around 0.5% in most of the countries, such as Germany, France, United Kingdom, etc., but some regions show a little higher. It is 2.1% in Switzerland, and it reaches 5.1% in Lyon (Rhône-Alpes) region of France. It is about 4% in Shetland of northernmost Britain, with a place in it showing the highest figure at 8%. Shetland has been known to be a settlement of Vikings. And, surprisingly, Q-M242 in Shetland (also in some areas of Scandinavia, Faroe Islands, Iceland, and the Great United Kingdom) has turned out to be generically closely linked to the Q-M242 in Central Asia, . Also, Shetland (Norse) Q-M242 is revealed to be linked to some Q-M242 of Azeris (Azerbaijan).

    Southern Europe

    Southern Europe also shows low frequencies of Q around 0.5%~1%, but some regions exhibits different figures. It is 1.9% in mainland Croatia, but it reaches 14.3% (13/91) in Hvar Islands and 6.1% (8/132) in Korčula. Also, it is about 0.6% in Italy, but it rises to 2.5% (6/236) in Sicily, where it reaches 16.7% (3/18) in Mazara del Vallo region, followed by 7.1% (2/28) in Ragusa, 3.6% in Sciacca, and 3.7% in Belvedere Marittimo.

    On the other hand, according to a study (Behar 2004), 5.2% (23/441) of Ashkenazi Jews males belong to haplogroup Q-P36. This has subsequently been found to be entirely the Q-M378 subclade and may be restricted to Q-L245. Also, 2.3% (4/174)~5.6% (3/53) of Sephardi Jews are in haplogroup Q.

    Africa

    Haplogroup Q is rarely found across North Africa. It is observed in 0.7% (1/147), of Egyptians and in 0.6% (1/156) of Algerian people. Surprisingly, it is also witnessed in 0.8% (3/381, all Q-M346) of males from Comoros which is located in between East Africa and Madagascar.

    To combine the data above, Q-M242 is estimated to be in about 3.1% of males of the world.

    Subclade distribution

  • Q (M242)
  • Q* — Found with low frequency in India and Pakistan. Important in Afghanistan, paragroup Q-M242 (xMEH2,xM378) was found at 16.3% in Pashtuns.
  • Q-P36.2 (P36.2) Found with low frequency in Iran.
  • Q-MEH2 (MEH2) Was found in Koryaks (at 10.3%), although the level of STR diversity associated with Q-MEH2 is very low, this lineage appears to be closest to the extinct Paleo-Eskimo individuals belonging to the Saqqaq culture arisen in the New World Arctic about 5.5 Ka.
  • Q-M120 (M120, M265/N14) — It is so far restricted to East Asia. It has been found at low frequency among Han Chinese, Dungans, Japanese, Koreans, Mongols in Mongolia, Tibetans, and Hmong Daw in Laos. It was reported in the Hazaras,
  • Q-M25 (M25, M143) — Found with high frequency of 30-45% in Turkmens and Turkmenistan Confused with R1b1 because of P25. Found with high frequency in Turkmens of Golestan Province (Iran), Jawzjan ( Afghanistan), and with low to moderate frequency in Lebanon, Mongolia, and Turkey
  • Q-M346 (L56, L57, M346) — Found at low frequency in Europe, South Asia and West Asia. It has been found in Pakistan, Iran, Afghanistan, Kyrgyzstan, Saudi Arabia, the United Arab Emirates, India, Mongolia, Tibet, and Bali.
  • Q-L53 (L53, L54, L55, L213)
  • Q-M3 (M3) — Common in indigenous peoples of the Americas
  • Q-M19 (M19) — Found among some indigenous peoples of South America, such as the Ticuna and the Wayuu
  • Q-M194 (M194) — In South America
  • Q-M199 (M199, P106, P292) — In South America
  • Q-M323 (M323) — It has been detected in Yemenite Jews.
  • Q-L275 (L275, L314)
  • Q-M378 (M378) — It is widely distributed in Europe, South Asia, West and East Asia. It is found among samples of Hazaras and Sindhis. It is also found in the Mongols, the Japanese people and the Uyghurs of North-Western China in two separate groups. The Q-M378 subclade and specifically its Q-L245 subbranch is speculated to be the branch to which Q-M242 men in European Jewish Diaspora populations belong. Although published articles have not tested for M378 in Jewish populations, genetic genealogists from the Ashkenazi, Mizrachi, and Sephardi Jewish populations have tested positive for both M378 and L245. Q-M378 samples also has been located in Central America (Panama) and South America (Andean Region)
  • Y-DNA Q samples from ancient sites

  • South Central Siberia(near Altai)
  • Afontova-Gora-2, Yenisei River Bank, Krasnoyarsk (South Central Siberia of Russia), 17000YBP: Q1a1-F1215 (mtDNA R)
  • North America
  • Anzick-1, Clovis culture, western Montana, 12600YBP: Q1a2-L54* (not M3, mtDNA D4h3a)
  • Kennewick Man, Washington, 8500YBP: Q1a2-M3 (mtDNA X2a)
  • Altai (West Mongolia)
  • Tsagaan Asga and Takhilgat Uzuur-5 Kurgan sites, westernmost Mongolian Altai, 2900YBP-4800YBP: 4 R1a1a1b2-Z93 (B.C. 10C, B.C. 14C, 2 period unknown), 3 Q1a2a1-L54 (period unknown), 1 Q-M242 (B.C. 28C), 1 C-M130 (B.C. 10C)
  • Greenland
  • Saqqaq (Qilakitsoq), Greenland, 4000YBP: Q1a-MEH2 (mtDNA D2a1)
  • Southern Siberia and Altai
  • In southern Siberia, Karasuk period(1500-800 B.C.) human remains at Sabinka (Khakasiya, Russia) from which three Y-DNA samples were extracted in one case appear to be Q1a:(Allentoft et al. (2015))
  • Sabinka 2 cemetery:
  • sample RISE493, male - 1531-1427 BC - Q1a1b1 (L712)
  • Ancient DNA samples from Hunnic-Sarmatian culture(400-200 B.C.) in Altai Mountains:
  • Sample RISE601, Iron Age archaeological site Verh-Uimon (Altai, Russia) (*L715)
  • Sample RISE600, Iron Age archaeological site Verh-Uimon (Altai, Russia) (*L713)
  • (cf.) Living individuals of Q-L712 Y-DNA are extremely rare. The list of modern individuals:
  • L712* paragroup (Q-L712+ Q-L713-):
  • Szekely (Szekler) subcluster (Q-L712+ Q-L715+ Q-L713+ Q-YP789+) - a common ancestor lived 1700 years ago. This coincides with the arrival of Huns in Europe in 370 AD.
  • Eurasian group (Q-L712+ Q-L715+ Q-L713+ Q-YP789+): Ireland, Poland, Russia, Uzbekistan. Similar to Székely Y-DNA profile, however ethnically not related with the Balkaria/Digora and Székely (Szekler) subcluster.
  • Balkaria/Digora subcluster (Q-L712+ Q-L715+ Q-BZ660+ Q-L713-) - a common ancestor lived 500 years ago. This coincides with the arrival of Badel and Basiat aristocracy in northern Caucasus and the fall of the Golden Horde in 1502.
  • China
  • Hengbei site (Peng kingdom cemetery of Western Zhou period), Jiang County, Shanxi, 2800-3000YBP: 9 Q1a1-M120, 2 O2a-M95, 1 N, 4 O3a2-P201, 2 O3, 4 O*
  • In another paper, the social status of those human remains of ancient Peng kingdom(倗国) are analyzed. aristocrats: 3 Q1a1 (prostrate 2, supine 1), 2 O3a (supine 2), 1 N (prostrate) / commoners : 8 Q1a1 (prostrate 4, supine 4), 3 O3a (prostrate 1, supine 2), 3 O* (supine 3) / slaves: 3 O3a, 2 O2a, 1 O*
  • (cf) Pengbo (倗伯), Monarch of Peng Kingdom is estimated as Q-M120.
  • Pengyang County, Ningxia, 2500YBP: all 4 Q1a1-M120 (with a lot of animal bones and bronze swords and other weapons, etc.)
  • Heigouliang, Xinjiang, 2200YBP: 6 Q1a* (not Q1a1-M120, not Q1a1b-M25, not Q1a2-M3), 4 Q1b-M378, 2 Q* (not Q1a, not Q1b: unable to determine subclades):
  • In a paper(Lihongjie 2012), the author analyzed the Y-DNAs of the ancient male samples from the 2nd or 1st century BCE cemetery at Heigouliang in Xinjiang – which is also believed to be the site of a summer palace for Xiongnu kings – which is east of the Barkol basin and near the city of Hami. The Y-DNA of 12 men excavated from the site belonged to Q-MEH2 (Q1a) or Q-M378 (Q1b). The Q-M378 men among them were regarded as hosts of the tombs; half of the Q-MEH2 men appeared to be hosts and the other half as sacrificial victims.
  • Hunnu (Xiongnu) site in Barkol, Xinjiang, all 3 Q-M3
  • In L. L. Kang et al. (2013), three samples from a Hunnu(Xiongnu) site in Barkol, Xinjiang were found to be Q-M3 (Q1a2a1a1). And, as Q-M3 is mostly found in Yeniseians and native Americans, the authors suggest that "Hunnu(Xiongnu) should be in the Yeniseian language family".
  • (cf) These discoveries from the above papers(Li 2012, Kang et al., 2013) have some positive implications on the not as yet clearly verified theory that the Xiongnu were precursors of the Huns.
  • Mongolian noble burials in the Yuan dynasty, Shuzhuanglou Site, northernmost Hebei China, 700YBP: all 3 Q (not analysed subclade, the principal occupant Gaodangwang Korguz (高唐王=趙王 阔里吉思)’s mtDNA=D4m2, two others mtDNA=A)
  • (cf) Korguz was a son of a princess of Kublai Khan (元 世祖), and was the king of the Ongud tribe. He died in 1298 and was reburied in Shuzhuanglou in 1311 by his son. (Do not confuse this man with the Uyghur governor, Korguz who died in 1242.) The Ongud tribe (汪古部) was a descendant of the Shatuo tribe (沙陀族) which was a tribe of Göktürks (Western Turkic Khaganate) and was prominent in the Five Dynasties and Ten Kingdoms period of China, building three dynasties. His two queens were all princesses of the Yuan dynasty (Kublai Khan's granddaughters). It was very important for the Yuan dynasty to maintain a marriage alliance with Ongud tribe which had been a principal assistant since Genghis Khan's period. About 16 princesses of the Yuan dynasty got married to kings of the Ongud tribe.
  • References

    Haplogroup Q-M242 Wikipedia


    Similar Topics
    ×