Samiksha Jaiswal (Editor)

Ciliate, dasycladacean and hexamita nuclear code

Updated on
Edit
Like
Comment
Share on FacebookTweet on TwitterShare on LinkedInShare on Reddit

The ciliate, dasycladacean and hexamita nuclear code (translation table 6) is a genetic code used by certain ciliate, dasycladacean and hexamita species.

Contents

The ciliate macronuclear code has not been determined completely. The codon UAA is known to code for Gln only in the Oxytrichidae.

The code

   AAs = FFLLSSSSYYQQCC*WLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = -----------------------------------M---------------------------- Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)

Systematic range

  • Ciliata: Oxytricha and Stylonychia, Paramecium, Tetrahymena, Oxytrichidae and probably Glaucoma chattoni.
  • Dasycladaceae: Acetabularia, and Batophora.
  • Diplomonadida:
  • References

    Ciliate, dasycladacean and hexamita nuclear code Wikipedia


    Similar Topics