Puneet Varma (Editor)

Vertebrate mitochondrial code

Updated on
Edit
Like
Comment
Share on FacebookTweet on TwitterShare on LinkedInShare on Reddit

The vertebrate mitochondrial code is the genetic code found in the mitochondria of all vertebrata.

Contents

Evolution

AGA and AGG were thought to have become mitochondrial stop codons early in vertebrate evolution. However, at least in humans it has now been shown that AGA and AGG sequences are not recognized as termination codons. A -1 mitoribosome frameshift occurs at the AGA and AGG codons predicted to terminate the CO1 and ND6 open reading frames (ORFs), and consequently both ORFs terminate in the standard UAG codon.

Incomplete stop codons

Mitochondrial genes in some vertebrates (including humans) have incomplete stop codons ending in U or UA, which become complete termination codons (UAA) upon subsequent polyadenylation.

Translation table

AAs    = FFLLSSSSYY**CCWWLLLLPPPPHHQQRRRRIIMMTTTTNNKKSS**VVVVAAAADDEEGGGGStarts = --------------------------------MMMM---------------M------------Base1  = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2  = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3  = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)

Alternative initiation codons

  • Bos: AUA
  • Homo: AUA, AUU
  • Mus: AUA, AUU, AUC
  • Coturnix, Gallus: also GUG
  • References

    Vertebrate mitochondrial code Wikipedia


    Similar Topics