Puneet Varma (Editor)

Invertebrate mitochondrial code

Updated on
Edit
Like
Comment
Share on FacebookTweet on TwitterShare on LinkedInShare on Reddit

The invertebrate mitochondrial code is a genetic code used by the mitochondrial genome of invertebrates.

Contents

The code

   AAs = FFLLSSSSYY**CCWWLLLLPPPPHHQQRRRRIIMMTTTTNNKKSSSSVVVVAAAADDEEGGGGStarts = ---M----------------------------MMMM---------------M------------ Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)

Note: The codon AGG is absent in Drosophila.

Alternative initiation codons:

  • AUA, AUU
  • AUC: Apis
  • GUG: Polyplacophora
  • UUG: Ascaris, Caenorhabditis
  • Systematic range

  • Nematoda: Ascaris, Caenorhabditis;
  • Mollusca: Bivalvia (Hoffmann et al., 1992); Polyplacophora (Boore and Brown, 1994)
  • Arthropoda/Crustacea: Artemia (Batuecas et al., 1988)
  • Arthropoda/Insecta: Drosophila [Locusta migratoria (migratory locust), Apis mellifera (honeybee)]
  • Other variations

  • Several arthropods translate the codon AGG as lysine instead of serine (as in the Pterobranchia Mitochondrial Code) or arginine (as in the standard genetic code) (Abascal et al., 2006).
  • GUG may possibly function as an initiator in Drosophila (Clary and Wolstenholme, 1985; Gadaleta et al., 1988). AUU is not used as an initiator in Mytilus (Hoffmann et al., 1992).
  • "An exceptional mechanism must operate for initiation of translation of the cytochrome oxidase subunit I mRNA in both D. melanogaster (de Bruijn, 1983) and D. yakuba (Clary and Wolstenholme 1983), since its only plausible initiation codon, AUA, is out of frame with the rest of the gene. Initiation appears to require the "reading" of an AUAA quadruplet, which would be equivalent to initiation at AUA followed immediately by a specific ribosomal frameshift. Another possible mechanism ... is that the mRNA is "edited" to bring the AUA initiation into frame." (Fox, 1987)
  • References

    Invertebrate mitochondrial code Wikipedia


    Similar Topics