Puneet Varma (Editor)

Alternative flatworm mitochondrial code

Updated on
Edit
Like
Comment
Share on FacebookTweet on TwitterShare on LinkedInShare on Reddit

The alternative flatworm mitochondrial code (translation table 14) is a genetic code found in the mitochondria of Platyhelminthes and Nematoda.

Contents

Code

   AAs = FFLLSSSSYYY*CCWWLLLLPPPPHHQQRRRRIIIMTTTTNNNKSSSSVVVVAAAADDEEGGGGStarts = -----------------------------------M---------------------------- Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)

Systematic range and comments

Platyhelminthes (flatworms) and Nematoda (roundworms).

Code 14 differs from code 9 (the echinoderm and flatworm mitochondrial code) only by translating UAA to Tyr rather than STOP. A study in 2000 has found no evidence that the codon UAA codes for Tyr in the flatworms but other opinions exist. There are very few GenBank records that are translated with code 14 but a test translation shows that re-translating these records with code 9 can cause premature terminations. More recently, UAA has been found to code for tyrosine in the nematodes Radopholus similis and Radopholus arabocoffeae.

References

Alternative flatworm mitochondrial code Wikipedia


Similar Topics