Rahul Sharma (Editor)

Yeast mitochondrial code

Updated on
Edit
Like
Comment
Share on FacebookTweet on TwitterShare on LinkedInShare on Reddit

The yeast mitochondrial code is a genetic code used by the mitochondrial genome of yeasts, notably Saccharomyces cerevisiae, Candida glabrata, Hansenula saturnus, and Kluyveromyces thermotolerans.

The code

   AAs = FFLLSSSSYY**CCWWTTTTPPPPHHQQRRRRIIMMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = ---M---------------M---------------M---------------M------------ Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)

  • The remaining CGN codons are rare in Saccharomyces cerevisiae and absent in Candida glabrata.
  • The AUA codon is common in the gene var1 coding for the single mitochondrial ribosomal protein, but rare in genes encoding the enzymes.
  • The coding assignments of the AUA (Met or Ile) and CUU (possibly Leu, not Thr) are uncertain in Hansenula saturnus.
  • The coding assignment of Thr to CUN is uncertain in Kluyveromyces thermotolerans.
  • References

    Yeast mitochondrial code Wikipedia


    Similar Topics