Girish Mahajan (Editor)

Pterobranchia mitochondrial code

Updated on
Edit
Like
Comment
Share on FacebookTweet on TwitterShare on LinkedInShare on Reddit

The pterobranchia mitochondrial code is a genetic code used by the mitochondrial genome of Rhabdopleura compacta (Pterobranchia). The Pterobranchia are one of the two groups in the Hemichordata which together with the Echinodermata and Chordata form the three major lineages of deuterostomes. AUA translates to isoleucine in Rhabdopleura as it does in the Echinodermata and Enteropneusta while AUA encodes methionine in the Chordata. The assignment of AGG to lysine is not found elsewhere in deuterostome mitochondria but it occurs in some taxa of Arthropoda. This code shares with many other mitochondrial codes the reassignment of the UGA STOP to tryptophan, and AGG and AGA to an amino acid other than arganine. The initiation codons in Rhabdopleura compacta are ATG and GTG.

The code

   AAs = FFLLSSSSYY**CCWWLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSSKVVVVAAAADDEEGGGGStarts = ---M---------------M---------------M---------------M------------ Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)

References

Pterobranchia mitochondrial code Wikipedia


Similar Topics
×