Puneet Varma (Editor)

Haplogroup G M201

Updated on
Edit
Like
Comment
Share on FacebookTweet on TwitterShare on LinkedInShare on Reddit
Possible time of origin
  
9,500-30,000 years BP

Ancestor
  
Haplogroup G-M201

Possible place of origin
  
Caucasus or Southwest Asia

Descendants
  
G1, G2 and their subclades

Defining mutations
  
L116, L154, L204, L240, L269, L402, L520, L521, L522, L523, L605, L769, L770, L836, L837, M201, P257/U6, Page94/U17, U2, U3, U7, U12, U20, U21, U23, U33

Haplogroup G (M201) is a human Y-chromosome haplogroup. It is one of two branches of Haplogroup GHIJK, the other being Haplogroup HIJK.

Contents

At the level of national populations, G-M210 is most commonly found in Georgia; it is found at even higher levels among many other regional and minority populations in The Caucasus. G-M210 is also widely distributed at low frequencies, among ethnic groups of Europe, South Asia, Central Asia, and North Africa.

The most commonly occurring subclades of Haplogroup G (with their corresponding SNPs in parentheses) are: G1 (M285), G2a (P15), G2a1 (L293), G2a3a (M406), G2a3b1a (L140), G2a3b1a2 (L497), G2a3b1a1a (L13/S131/U13), G2a3b1a3 (Z1903) and G2b (M377).

Origins

Various estimated dates and locations have been proposed for the origin of Haplogroup G.

In 2012, a paper by Siiri Rootsi et al. suggested that: "We estimate that the geographic origin of hg G plausibly locates somewhere nearby eastern Anatolia, Armenia or western Iran."

Previously the National Geographic Society places its origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic.

Two scholarly papers have also suggested an origin in the Middle East, while differing on the date. Semino et al. (2000) suggested 17,000 years ago. Cinnioglu et al. (2004) suggested the mutation took place only 9,500 years ago.

The only known example of the basal paragroup G (xG1,G2) (G-M210*) is a blood sample said to have come from a man executed on a guillotine during the French Revolution. (See below for further details.)

Structure

G* (M201)

  • G1 (M285, M342)
  • G1a (P20.1, P20.2, P20.3)
  • G1a1 (L201, L202, L203)
  • G1b (L830, L831, L832, L834, L835)
  • G2 (P287)
  • G2a (P15, U5, L31/S149, L149)
  • G2a1 (L293^)
  • G2a1a (P16.1, P16.2)
  • G2a1a1 (P18.1, P18.2, P18.3)
  • G2a2 (L223^)
  • G2a2a (M286)
  • G2a2b (L91)
  • G2a2b1 (L166, L167)
  • G2a3 (L30/S126, L32/S148, L190/M485)
  • G2a3a (M406)
  • G2a3a1 (L14/Page57/S130/U16, L90/S133)
  • G2a3a2 (L645)
  • G2a3b (L141.1)
  • G2a3b1 (P303/S135)
  • G2a3b1a (L140)
  • G2a3b1a1 (U1)
  • G2a3b1a1a (L13/S131/U13, L78/M527)
  • G2a3b1a1a1 (L1263^)
  • G2a3b1a1b (L1266^)
  • G2a3b1a1b1 (L1264^, L1265^, L1268^)
  • G2a3b1a2 (L497, L353.1^,L353.2^)
  • G2a3b1a2a (Z725^)
  • G2a3b1a2a1 (L43/S147)
  • G2a3b1a2a1a (L42/S146)
  • G2a3b1a3 (Z1903^)
  • G2a3b1a3a (Z724^)
  • G2a3b1a3a1 (L640)
  • G2a3b1a4 (L660, L662)
  • G2a3b1b (L694)
  • G2a3b2 (L177.1, L177.2, L177.3)
  • G2b (M377, L72, L183)
  • G2b1 (M283)
  • (Subclades here conform to the Y-DNA SNP definitions used by ISOGG In 2012, several categories found only in one man in research studies were removed from the ISOGG tree causing some renaming.)

    Prehistoric presence

    Haplogroup G2a (G-P15) has been identified in neolithic human remains in Europe dating between 5000-3000 BC.

    Furthermore, the majority of all the male skeletons from the European Neolithic period have so far yielded Y-DNA belonging to this haplogroup. The oldest skeletons confirmed by ancient DNA testing as carrying haplogroup G2a were five found in the Avellaner cave burial site, near Les Planes d'Hostoles, in Catalonia, Spain and were dated by radiocarbon dating to about 5000 BCE.

    A skeleton found at the Neolithic cemetery known as Derenburg Meerenstieg II, in Saxony-Anhalt Germany, apparently belonged to G2a3 (G-S126) or a subclade. It was found with burial artifacts belonging to the Linearbandkeramische Kultur ("Linear Band Ceramic Culture"; LBK). This skeleton could not be dated by radiocarbon dating, but other skeletons there were dated to between 5,100 and 6,100 years old. The most detailed SNP mutation identified was S126 (L30), which defines G2a3.

    G2a was found also in 20 out of 22 samples of ancient Y-DNA from Treilles, the type-site of a Late Neolithic group of farmers in the South of France, dated to about 5000 years ago. The fourth site also from the same period is the Ötztal of the Italian Alps where the mummified remains of Ötzi the Iceman were discovered. The Iceman belongs to haplogroup G2a2b (earlier called G2a4).

    Haplogroup G2a2b is a rare group today in Europe. The authors of the Spanish study indicated that the Avellaner men had rare marker values in testing of their short tandem repeat (STR) markers.

    Historic presence

    Two men found in a high-status 7th Century burial at Ergolding in Bavaria, Germany, were found to belong to haplogroup G2a (P15+). The burials have been linked to the Merovingian dynasty.

    The only known example of the basal paragroup G(xG1,G2) (G-M210*) was blood found on a handkerchief, sealed in a gourd in France during the 18th Century. The handkerchief reputed to have come from a man who underwent public execution by guillotine during the French Revolution. The blood is said to have belonged to King Louis XVI of France (1754 – 1793), although its provenance is far from certain. Public executions were notoriously chaotic at the time and some of those executed were neither members of the royal family, or even the aristocracy.

    Modern presence

    In Russia, Ukraine and Central Asia, members of various ethnic minorities and/or residents in particular localities possess G-M201 at its highest levels in the world – even though the average rate at the national level is about 1% or less. The Madjars and Argyn klans of Kazakhstan were found to possess the highest levels of G-M201 among any modern ethnic group. Amongst the Madjars, G1 was found at a rate of 87%. A separate study on the Argyns found that 71% of males belong to G1. In the Russian North Caucasus the Kabardinian and Ossetian populations are also notable for high rates of G-M201. Digora, North Ossetia has the highest known concentration of G in a single city, as 74% of the tested men were G. Haplogroup G is found as far east as northern China in small percentages where G can reach more substantial percentages in minority groups such as the Uyghurs.

    In Turkey, the South Caucasus and Iran, haplogroup G reaches the highest percentage of national populations. Among Turkish males 11% of the population is G. In Iran, Haplogroup G reaches 13 to 15% of the population in various parts of the country. While it is found in percentages higher than 10% among the Bakhtiari, Gilaki and Mazandarani, it is closer to 5% among the Iranian Arabs and in some large cities. Among the samples in the YHRD database from the southern Caucasus countries, 29% of the samples from Abazinia, 31% from Georgia, 18% from Azerbaijan and 11% from Armenia appear to be G samples.

    In Europe west of the Black Sea, Haplogroup G is found at about 5% of the population on average throughout most of the continent. The concentration of G falls below this average in Scandinavia, the westernmost former Soviet republics and Poland, as well as in Iceland and the British Isles. There are seeming pockets of unusual concentrations within Europe. In Wales, a distinctive G2a3b1 type (DYS388=13 and DYS594=11) dominates there and pushes the G percentage of the population higher than in England.

    In the Tirol (Tyrol) of western Austria, the percentage of G-M210 can reach 40% or more; perhaps the most famous example is the ancient remains of the so-called "Iceman", Ötzi. In the northern and highland areas of the island of Sardinia off western Italy, G percentages reach 11% of the population in one study and reached 21% in the town of Tempio in another study. In the Greek island of Crete, approximately 7% to 11% of males belong to haplogroup G. In north-eastern Croatia, in the town of Osijek, G was found in 14% of the males. The city is on the banks of the river Drava, which notably begins in the Tirol/Tyrol region of the Alps, another haplogroup G focus area in Europe. Farther north, 8% of ethnic Hungarian males and 5.1% of ethnic Bohemian (Czech) males have been found to belong to Haplogroup G.

    In South Asia, some ethnic minorities possess haplogroup G at concentrations of approximately 18% to 20% of Kalash, approximately 16% of Brahui, and approximately 11.5% of sampled Pashtun, but in only about 3% of the general Pakistani population. The many groups in India and Bangladesh have not been well studied. About 6% of the samples from Sri Lanka and Malaysia were reported as haplogroup G, but none were found in the other coastal lands of the Indian Ocean or Pacific Ocean in Asia.

    In the Middle East, haplogroup G accounts for about 3% of the population in almost all areas. Among the Druze mostly residents of Israel 10% were found to be haplogroup G.

    Around 10% of Jewish males are Haplogroup G.

    In Africa, haplogroup G is rarely found in sub-Saharan Africa or south of the horn of Africa among native populations. In Egypt, studies have provided information that pegs the G percentage there to be between 2% and 9%. 3% of North African Berbers were found to be haplogroup G. 2% of Arab Moroccans and 8% of Berber Moroccans were likewise found to be G.

    In the Americas, the percentage of haplogroup G corresponds to the numbers of persons from Old World countries who emigrated. It is not found among Native Americans except where intermarriage with non-native persons has occurred. It has been found in Mexican mestizos.

    G1 (M285+ or M342+) and its subclades

    Almost all haplogroup G1 persons have the value of 12 at short tandem repeat (STR) marker DYS392 and all will have the M285 or M342 SNP mutation which characterizes this group. This value of 12 is uncommon in other G categories other than G1.

    subclades of G1a, G1a1, G1b exist.

    The highest reported concentration of G1 and its subclades in a single country is in Iran, with next most frequent concentrations in neighboring countries to the west.

    There are distinctive Ashkenazi Jewish and Kazakh subclades based on STR marker value combinations.

    G2 (P287+)

    Men who belong to this group but are negative for all G2 subclades represent a small number of haplogroup G men. P287 was identified at the University of Arizona and became widely known in late 2007. Its identification caused considerable renaming of G categories.

    G2a (P15+)

    Haplogroup G men who belong to this group, but are negative for all G2a subclades, are uncommon in Europe but may represent a sizeable group in so far poorly tested areas east of Turkey. P15 was identified at the University of Arizona and became widely known by 2002. Its chromosome location listed as 21653414. G2a was found in medieval remains in a 7th- century CE high-status tomb in Ergolding, Bavaria, Germany, but G2a subclades were not tested.

    There are multiple SNPs which so far have the same coverage as P15. They are—with accompanying Y-chromosome locations—U5 (rs2178500), L149 (8486380) and L31 (also called S149) (rs35617575..12538148). Should any man with the P15 mutation test negative (ancestral) for any of these or vice versa, that finding would be the basis of a new G2a category.

    G2a1 (L293+) and its subclades

    Haplogroup G2a1 and its subclades represent the majority of haplogroup G samples in some parts of the Caucasus Mountains area. They are found only in tiny numbers elsewhere. So far all G2a1 persons have a value of 10 at STR marker DYS392. G2a1a persons also typically have higher values for DYS385b, such as 16, 17 or 18, than seen in most G persons.

    The North Ossetians in the mid northern Caucasus area of Russia belong overwhelmingly to the G2a1 subclade based on available samples. The South Ossetians and Svans generally south of North Ossetia have significant number of G2a1 persons, but population percentages have not yet been provided.

    The presence of the SNP P18 mutation characterizes G2a1a's only subclade, G2a1a. The reliability of both P16 and P18 in identifying everyone in each of these categories has been questioned and individual components of the SNP have to be examined.

    Ashkenazi Jewish G2a1a men with northeastern European ancestry form a distinct cluster based on STR marker values. Men from the Caucasus and men from eastern Europe also form distinctive STR clusters.

    G2a2 (L223+) and its subclades

    This group is charactized by having the L223 mutation. L223 is found on the Y chromosome at rs13304806 and 6405148 with a mutation from C to G. L223 was first identified in samples at 23andMe in 2009 but proved problematic as an individual test, the first successful results being reported at Family Tree DNA in late 2011 under its assigned L223 label. It was then learned that three subclades as follows belong under L223:

    The G2a2a subclade (M286) is tiny. Samples indicating British Isles, Turkish and Lebanese ancestry have been identified. The British samples have inconsistent double values for STR marker DYS19 in many cases. M286 was first identified at Stanford University at chromosome position 21151187, and is a mutation from G to A.

    G2a2b (G-L91) was identified in 2009. Its members include "Ötzi", the so-called Iceman, who died at least 5,000 years BP in the European Alps. G2a2b would seem to encompass a significant proportion of men belonging to G. L91 is found so far in scattered parts of Europe and North Africa and in Armenia. Included within G2a2b are some men with double values for STR marker DYS19, but there are also G2a2 men with this finding who are not G2a2b. The double 19 value situation is not seen in the G2a1 and G2a3 subclades. The L91 mutation is found at 21327383 and rs35474563 on the Y-chromosome. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. The mutation involves a change from C to T.[16] L223 is found on the Y chromosome at rs13304806.

    The L293 SNP that characterizes the G2a2c subclade was identified in June 2010 at Family Tree DNA. It encompasses a small group of Hispanic men who also so far all have the odd value of 13,21 at the YCA marker. The mutation is found on the Y chromosome at 10595022 and is a change from G to C.

    G2a3 (L30+, S126+, U8+)

    Men who belong to this group but are negative for all its subclades represent a small number today. This haplogroup was found in a Neolithic skeleton from around 5000 BC, in the cemetery of Derenburg Meerenstieg II, Germany, which forms part of the Linear Pottery culture, known in German as Linearbandkeramik (LBK), but was not tested for G2a3 subclades.

    G2a3a (M406+) and its subclades

    G2a3a and its several subclades seem most commonly found in Turkey and the coastal areas of the eastern Mediterranean where it can constitute up to 50% of haplogroup G samples. G2a3a is more common in southern Europe than northern Europe. In Europe—except in Italy – G2a3a constitutes less than 20% of G samples. G2a3a so far has seldom surfaced in northern Africa or southern Asia, but represents a small percentage of the G population in the Caucasus Mountains region and in Iran.

    A relatively high percentage of G2a3a persons have a value of 21 at STR marker DYS390. The DYS391 marker has mostly a value of 10, but sometimes 11, in G2a3a persons, and DYS392 is almost always 11. If a sample meets the criteria indicated for these three markers, it is likely the sample is G2a3a.

    G2a3a has two known subclades. Both are relatively common among G2a3a persons.

    G2a3b (L141+)

    The SNP that defines this group was identified only in mid-2009 at Family Tree DNA. Almost all L141+ men belong to L141 subclades. Samples from persons with British Isles, Sicilian and Turkish ancestry have been identified. L141+ persons who do not belong to any L141 subclade so far have the value of 11 at STR marker DYS490 — a finding rare in other G categories. The L141 mutation is found on the Y chromosome at 2948607. The L141 mutation involves an insertion.

    G2a3b1 (P303+ or S135+) and its subclades

    The G2a3b1 definable subclades are heavily concentrated throughout Europe west of the Black Sea and Russia where G2a3b1 is often in the majority among G persons. Small percentages of G2a3b1 are found primarily in the area encompassed by Turkey, the Caucasus countries, Iran and the Middle East where the G2a3b1 SNP may have originated. G2a3b1 is also found in India. The great majority of P303+ men belong to one of its subclades.

    The largest G2a3b1 subclade based on available samples is one in which almost all persons have the value of 13 at STR marker DYS388. The L497 SNP (G2a3b1a2) encompasses these men, but most men L497 men belong to its subclade Z725. There are additional subclades of DYS388=13 men characterized by the presence of specific SNPs or uncommon STR marker oddities. Members of this group have been found in Europe and the Middle East.

    The next largest G2a3b1 subclade is characterized by the presence of the U1 mutation (G2a3b1a1) But a high percentage of U1+ men belong to its two subclades, L13/S13 (G2a3b1a1a)and Z1266 (G2a3b1a1b). The L13 subclade is most common in north central Europe, and Z1266 is most common in the western Caucasus Mountains.

    The final major subclade is characterized by presence of the Z1903 SNP and so far by the value of 9 at marker DYS568. A high percentage of Z1903+ men belong to its subclade, Z724. The Z724 subclade contains a further large subclade consisting overwhelmingly of Ashkenazi Jews.

    The highest percentage of G2a3b1 persons in a discrete population so far described is on the island of Ibiza off the eastern Spanish coast. This group has been linked with the Crypto-Jewish population which fled to the island during the time of the Spanish Inquisition, of which a significant portion are identifiable as DYS388=13 persons.

    G2a3b2 (L177+)

    This G2a3b2 group is certainly smaller in numbers of men included than G2a3b1, but only a small amount of testing has occurred for the L177 mutations. So far the men positive for this have listed Irish, English, Dutch, Lebanese and Turkish (Armenian surname) ancestry. Several L177 subclades based on shared STR marker oddities exist.

    The number of STR marker values separating men in this group suggest G2a3b2 is a relatively old group despite the small number of men involved. The mutations involved are complicated and difficult to interpret. The L177.1 component is found at Y chromosome position 23397163; L177.2 at 25030912; L177.3 at 25750264. This SNP was first identified at Family Tree DNA in 2009.

    G2b (M377+) and its subclade

    Until August, 2012, this subclade was designated G2c. A clade of closely related Ashkenazi Jews represent virtually all G2b persons, with just three other G2b haplotypes having been reported so far: one Turk from Kars in northeast Turkey near Armenia, one Pashtun, and one Burusho in Pakistan.

    The extreme rarity of G2b in northern Pakistan could indicate that G2b in this area originates outside the region and was brought there in the historic period, perhaps from further west (Pakistan was part of both the Achaemenid Persian Empire, conquered by Alexander the Great, and then formed a part of the Greco-Bactrian Kingdom). These two reported Pakistani G2c haplotypes are quite divergent from the Ashkenazi Jewish clade, and therefore do not at all indicate a recent common origin. The Turkish G2b is somewhat closer, but not identical. It remains to be seen if testing will reveal G2b haplotypes in other populations — this is some indication that G2b occurs at low levels in the Near East. All G2b men tested so far have a rare null value for the DYS425 marker, (a missing "T" allele of the DYS371 palindromic STR), the result of a RecLOH event, a finding not yet seen among most other G haplotypes. Among Jews in Israel drawn from many areas of the world, G2b constituted 3.7% in one study.

    Haplogroup G2b has been found at a frequency of 60% out of a sample of five Pashtuns in the Wardak region of Afghanistan. This is likely due to a local founder effect.

    Defining SNPs

    The International Society of Genetic Genealogy (ISOGG) maintains the most up-to-date consensus version of haplogroup categories. These classifications are based on shared SNP mutations. The discovery of new SNPs can result in assignment of new names to haplogroup categories. There were only a few G categories until 2008 when major revisions to categories were made. Even more G SNPs were identified in 2009 to 2012 leading to more changes. Until 2008, new G SNPs were reported from labs at the University of Arizona (P designations), Stanford University (M designations) or the University of Central Florida (U designations). Beginning in 2008, additional G SNPs were identified at Family Tree DNA (L designations) and Ethnoancestry (S designations). These latter labs also made use of raw data results reported by individuals tested for about 2,000 SNPs at 23andMe to provide new L or S-designated SNP tests. In 2009-10, Family Tree DNA's Walk through the Y Project, sequencing certain Y-chromosome segments, provided a number of new G SNPs with the L designation. In 2012, SNPs with the Z designation as first identified by citizen researchers from 1000 Genomes Project data began to appear.

    Because SNPs provide the most reliable method of categorization, each is allowed to represent an official G category. Categories have alternating letters and numbers. But unusual values or unusual value combinations found at short tandem repeat markers (STRs) can also provide the basis of additional taxonomisation. The identification of a new SNP can necessitate renaming of one or more categories.

    The M201 SNP mutation that characterizes haplogroup G was identified at Stanford University and was first reported in 2001. The technical specifications of M201 are given as: refSNPid is rs2032636.....Y chromosome location of 13536923....forward primer is tatgcatttgttgagtatatgtc.....reverse primer is gttctgaatgaaagttcaaacg.....the mutation involves a change from G to T.

    A number of SNPs have been identified with seemingly the same coverage in the population as M201. Because M201 was identified first, it is the standard SNP test used when testing for G persons. In order to determine if one of these alternative SNPs represents a subclade of M201, the alternative SNPs must be tested in G persons who are negative for the known subclades of G. There are only a tiny number of persons in such a category, and only a tiny number of persons have been tested for G equivalent SNPs other than M201.

    The following SNPs are so far identified as M201 equivents: L116, L154, L269, L294, L240, P257, L402, L520, L521, L522, L523, L605, Page 94, U2, U3, U6, U7, U12, U17, U20, U21, U23 and U33. P257 was first reported in 2008. L240 was identified in 2009. The "U" SNPs were identified in 2006 but not published until 2009.

    In addition, there are multiple other SNPs thought to have the same coverage as M201. These are found at: rs9786910, rs9786537, rs2713254, rs35567891 and rs34621155 on the Y chromosome. No labs have yet assigned them shorthand names.

    Prominent members of G-M201

    The man known as "Ötzi" – whose remains, dating from the 4th millennium BCE, were found on the modern border between Austria and Italy – is a member of G-L91 (G2a2b).

    Recently, the English Plantagenet king, Richard III, has been forensically confirmed and verified as a bearer of a sub-variant of G-M201.

    Joseph Stalin, from a genetic test on his grandson (his son Vasily's son; Alexander Burdonsky), shows his Y-DNA haplogroup to be G2a1a:

    Other people purportedly members of Haplogroup G include: King Louis XVI of France, German-American pioneer and soldier Phillip Hamman, politician Linn Banks, physicist John G. Cramer, actor James Franciscus, lawyer and administrator Newton Minow, and male members of the Swedish Bure kinship (G2a3b1a2-Y12970).

    References

    Haplogroup G-M201 Wikipedia


    Similar Topics
    ×