Harman Patil (Editor)

Bacterial, archaeal and plant plastid code

Updated on
Edit
Like
Comment
Share on FacebookTweet on TwitterShare on LinkedInShare on Reddit

The bacterial, archaeal and plant plastid code is the DNA code used by bacteria, archaea, prokaryotic viruses and chloroplast proteins.

The code

   AAs = FFLLSSSSYY**CC*WLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = ---M---------------M------------MMMM---------------M------------ Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)

As in the standard code, initiation is most efficient at AUG. In addition, GUG and UUG starts are documented in archaea and bacteria (Kozak 1983, Fotheringham et al. 1986, Golderer et al. 1995, Nolling et al. 1995, Sazuka & Ohara 1996, Genser et al. 1998, Wang et al. 2003). In Escherichia coli, UUG is estimated to serve as initiator for about 3% of the bacterium's proteins (Blattner et al. 1997). CUG is known to function as an initiator for one plasmid-encoded protein (RepA) in E. coli (Spiers and Bergquist, 1992). In addition to the NUG initiations, in rare cases bacteria can initiate translation from an AUU codon as e.g. in the case of poly(A) polymerase PcnB and the InfC gene that codes for translation initiation factor IF3 (Polard et al. 1991, Liveris et al. 1993, Sazuka & Ohara 1996, Binns & Masters 2002). The internal assignments are the same as in the standard code though UGA codes at low efficiency for tryptophan in Bacillus subtilis and, presumably, in Escherichia coli (Hatfiled and Diamond, 1993).

References

Bacterial, archaeal and plant plastid code Wikipedia


Similar Topics
×