Ancestor I* (M170) | ||
![]() | ||
Possible time of origin 3,170–5,070 BP (previously 11,000 BP to 33,000 BP) Descendants I1a (DF29/S438);I1b (S249/Z131);I1c (Y18119/Z17925) Defining mutations M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, L187 |
Haplogroup I-M253, also known as I1, is a Y chromosome haplogroup. The genetic markers confirmed as identifying I-M253 are the SNPs M253,M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187. It is a primary branch of Haplogroup I-M170 (I*).
Contents
The haplogroup reaches its peak frequencies in Sweden (52 percent of males in Västra Götaland County) and western Finland (more than 50 percent in Satakunta province). In terms of national averages, I-M253 is found in 35–38 per cent of Swedish males, 32.8% of Danish males, about 31.5% of Norwegian males, and about 28% of Finnish males.
Haplogroup I-M253 is a primary branch of haplogroup I* (I-M170), which has been present in Europe since ancient times. The other primary branch of I* is I-M438, also known as I2.
Before a reclassification in 2008, the group was known as I1a, a name that has since been reassigned to a primary branch, haplogroup I-DF29. The other primary branches of I1 (M253) are I1b (S249/Z131) and I1c (Y18119/Z17925).
Origins
According to a study published in 2010, I-M253 originated between 3,170 and 5,000 years ago, in Chalcolithic Europe. A new study in 2015 estimated the origin as between 3,470 and 5,070 years ago or between 3,180 and 3,760 years ago, using two different techniques. It is suggested that it initially dispersed from the area that is now Denmark.
A 2014 study in Hungary uncovered remains of nine individuals from the Linear Pottery culture, one of whom was found to have carried the M253 SNP which defines Haplogroup I1. This culture is thought to have been present between 6,500 and 7,500 years ago.
Structure
I-M253 (M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187) or I1
Geographical distribution
I-M253 is found at its highest density in Northern Europe and other countries that experienced extensive migration from Northern Europe, either in the Migration Period, the Viking period or modern times. It is found in all places invaded by the ancient Germanic peoples and the Vikings.
During the modern era, significant I-M253 populations have also taken root in immigrant nations and former European colonies such as the United States, Australia and Canada.
Britain
In 2002 a paper was published by Michael E. Weale and colleagues showing genetic evidence for population differences between the English and Welsh populations, including a markedly higher level of Y-DNA haplogroup I in England than in Wales. They saw this as convincing evidence of Anglo-Saxon mass invasion of eastern Great Britain from northern Germany and Denmark during the Migration Period. The authors assumed that populations with large proportions of haplogroup I originated from northern Germany or southern Scandinavia, particularly Denmark, and that their ancestors had migrated across the North Sea with Anglo-Saxon migrations and Danish Vikings. The main claim by the researchers was
that an Anglo-Saxon immigration event affecting 50–100% of the Central English male gene pool at that time is required. We note, however, that our data do not allow us to distinguish an event that simply added to the indigenous Central English male gene pool from one where indigenous males were displaced elsewhere or one where indigenous males were reduced in number … This study shows that the Welsh border was more of a genetic barrier to Anglo-Saxon Y chromosome gene flow than the North Sea … These results indicate that a political boundary can be more important than a geophysical one in population genetic structuring.
In 2003 a paper was published by Christian Capelli and colleagues which supported, but modified, the conclusions of Weale and colleagues. This paper, which sampled Great Britain and Ireland on a grid, found a smaller difference between Welsh and English samples, with a gradual decrease in Haplogroup I frequency moving westwards in southern Great Britain. The results suggested to the authors that Norwegian Vikings invaders had heavily influenced the northern area of the British Isles, but that both English and mainland Scottish samples all have German/Danish influence.
Prominent members of I-M253
Alexander Hamilton, through genealogy and the testing of his descendants (assuming actual paternity matching his genealogy), has been placed within Y-DNA haplogroup I-M253.
Birger Jarl, 'Duke of Sweden' of the Goths House of Bjalbo, founder of Stockholm, had his Church buried remains tested in 2002 and found to be also I-M253
Markers
The following are the technical specifications for known I-M253 haplogroup SNP and STR mutations.
Name: M253
Type: SNPSource: M (Peter Underhill of Stanford University)Position: ChrY:13532101..13532101 (+ strand)Position (base pair): 283Total size (base pairs): 400Length: 1ISOGG HG: I1Primer F (Forward 5′→ 3′): GCAACAATGAGGGTTTTTTTGPrimer R (Reverse 5′→ 3′): CAGCTCCACCTCTATGCAGTTTYCC HG: I1Nucleotide alleles change (mutation): C to TName: M307
Type: SNPSource: M (Peter Underhill)Position: ChrY:21160339..21160339 (+ strand)Length: 1ISOGG HG: I1Primer F: TTATTGGCATTTCAGGAAGTGPrimer R: GGGTGAGGCAGGAAAATAGCYCC HG: I1Nucleotide alleles change (mutation): G to AName: P30
Type: SNPSource: PS (Michael Hammer of the University of Arizona and James F. Wilson, at the University of Edinburgh)Position: ChrY:13006761..13006761 (+ strand)Length: 1ISOGG HG: I1Primer F: GGTGGGCTGTTTGAAAAAGAPrimer R: AGCCAAATACCAGTCGTCACYCC HG: I1Nucleotide alleles change (mutation): G to ARegion: ARSDPName: P40
Type: SNPSource: PS (Michael Hammer and James F. Wilson)Position: ChrY:12994402..12994402 (+ strand)Length: 1ISOGG HG: I1Primer F: GGAGAAAAGGTGAGAAACCPrimer R: GGACAAGGGGCAGATTYCC HG: I1Nucleotide alleles change (mutation): C to TRegion: ARSDP