Harman Patil (Editor)

Helix Bridge

Updated on
Edit
Like
Comment
Share on FacebookTweet on TwitterShare on LinkedInShare on Reddit
Carries
  
Pedestrians

Official name
  
The Helix

Address
  
Total length
  
280 m

Clearance below
  
8.8 m

Bridge type
  
Footbridge

Crosses
  
Material
  
Construction started
  
2007

Opened
  
24 April 2010

Location
  
Helix Bridge

Locale
  
Downtown Core, Singapore

Owner
  
Urban Redevelopment Authority, Singapore

Similar
  
Marina Bay - Singapore, ArtScience Museum, Singapore Flyer, Gardens by the Bay, Marina Bay Sands

Singapore helix bridge hd 2015


The Helix Bridge, officially The Helix, and previously known as the Double Helix Bridge, is a pedestrian bridge linking Marina Centre with Marina South in the Marina Bay area in Singapore. It was officially opened on 24 April 2010 at 9 pm; however, only half was opened due to ongoing construction at the Marina Bay Sands. It is located beside the Benjamin Sheares Bridge and is accompanied by a vehicular bridge, known as the Bayfront Bridge. The entire bridge was opened on 18 July 2010 to complete the entire walkway around Marina Bay.

Contents

Helix bridge singapore


Architecture

The design consortium is an international team comprising Australian architects the Cox Architecture and engineers Arup, and Singapore based Architects 61.

Canopies (made of fritted-glass and perforated steel mesh) are incorporated along parts of the inner spiral to provide shade for pedestrians. The bridge has four viewing platforms sited at strategic locations which provide stunning views of the Singapore skyline and events taking place within Marina Bay. At night, the bridge will be illuminated by a series of lights that highlight the double-helix structure, thereby creating a special visual experience for the visitors.

Pairs of coloured letters c and g, as well as a and t on the bridge which are lit up at night in red and green represent cytosine, guanine, adenine and thymine, the four bases of DNA. The intentional left handed DNA-like design, which is the opposite of normal DNA on earth, earned it a place in The Left Handed DNA Hall of Fame in 2010.

The Land Transport Authority claimed it is a world first in architectural and engineering bridge design. It won the 'World's Best Transport Building' award at the World Architecture Festival Awards in the same year. It has also been recognised by the Building and Construction Authority (BCA) at the BCA Design and Engineering Safety Excellence Awards in 2011.

Design

From the outset, the project posed several challenges. There was a desire for the plan view of the bridge to be curved in an arc, such that it joins the foreshore promenades on either side seamlessly. Furthermore, it was desirable to create a lightweight structure, in contrast to the adjacent 6-lane vehicle bridge which is rather heavy in appearance.

Due to the tropical climate, the brief also required the bridge to provide shade and shelter against direct sunshine and heavy rainfall. The combination of these factors, together with the desire to create a landmark structure, led to a novel and unique design. The bridge was designed using BS 5950 in combination with a design guide from the SCI.

The resulting bridge comprises two delicate helix structures that act together as a tubular truss to resist the design loads. This approach was inspired by the form of the curved DNA structure. The helix tubes only touch each other in one position, under the bridge deck. The two spiraling members are held apart by a series of light struts and rods, as well as stiffening rings, to form a rigid structure. This arrangement is strong and ideal for the curved form. The stainless steel bridge is met by concrete abutments at either side.

The 280 m bridge is made up of three 65 m spans and two 45 m end spans. If the steel were stretched out straight from end to end, it would measure 2.25 km in length. The major and minor helices, which spiral in opposite directions, have an overall diameter of 10.8 m and 9.4 m respectively, about 3-stories high. The outer helix is formed from six tubes (273 mm in diameter) which are set equidistant from one another. The inner helix consists of five tubes, also 273 mm in diameter. Over the river, the bridge is supported by unusually light tapered stainless steel columns, which are filled with concrete. The columns form inverted tripod shapes which support the bridge above each of the pilecaps. The bridge weighs around 1700 tonnes in total.

The final pieces of the design are a series of ovular-shaped cantilevered viewing ‘pods’, each with capacity for about 100 people, that extend out on the bay side to create ‘ring-side’ viewing for water events. These decks are also constructed using grade 1.4462 and are designed to further optimize the pedestrian experience of the bridge as a new urban place and a vital connection between Singapore’s major existing and emerging urban precincts.

Because this structure was inspired by the DNA structure, it appeared essential that the architectural lighting features should emphasise the various shapes and curves. Towards that end, a series of dynamic multi-coloured light-emitting diode (LED) lights are installed on the helix structures. Outward-facing lights accentuate the sweeping structural curves, with another discreet array of lights illuminating the internal canopy of glass and steel mesh to create a dynamic membrane of light. The inner helix uses white light to illuminate a path for pedestrians. The lights work particularly well with the surface finish and colour of the stainless steel elements.

Analysis

Extensive numerical analysis was completed in order to explore possible solutions, using the engineer’s in-house structural optimisation software. This enabled a method to be found of linking the two helices. It also ensured that the steel sections are used to their maximum capacity in supporting the pedestrian deck, shade canopies and light fixtures. Prior to specifying materials, or even finalising the designs, the bridge was fully modelled using three-dimensional software in order to visualise its form and geometrical compatibility, as well as to visualise the pedestrian experience on the bridge.

Non-linear analysis was also carried out to assess the response under various load cases and to analyse the serviceability requirements such as vibration. It was also important to carry out robustness studies in order to examine the behaviour that would arise if the structure were subjected to accidental or deliberate removal of a helix or supporting member.

Construction

The Helix is fabricated from approximately 650 tonnes of Duplex Stainless Steel and 1000 tonnes of carbon steel used in the temporary structure and also helping the bridge to get the helix shape.

The construction of the bridge was undertaken by the collaboration of Sato Kogyo Pte Ltd and TTJ Design and Engineering Pte Ltd. Both companies had their full support to help to create this bridge. Sato Kogyo specialized in building a concrete span bridge which is located parallel to the Helix bridge while TTJ Design and Engineering led in the fabrication and erection of the Helix structure. Key personnel in the project from TTJ Design and Engineering were Mr Teo Hock Chwee (Managing Director, Mr Gaynel Velasco (Senior Project Manager), Mr Arnel Alcorin (APM), Mr Tiung Chee Wee (Engr) and many others who contributed to the whole span of the bridge. Hundred of workers have contributed to the completion of the bridge.

Fabrication

Before any work began on the actual bridge, a mock-up was made of carbon steel to try and preempt certain difficulties. Fabrication of the elements worked from the North to the South, components being assembled into segments that could manage the Singapore roads. A trial assembly was done before delivery to site to identify any prefabrication errors.

Quality control

The duplex stainless steel used is susceptible to contamination by carbon or zinc dust. So a dedicated workshop was specially set up to keep members for the Helix separate from other carbon and galvanized steels.

Temporary works

A temporary truss bridge was built to support the bridge and provide access. The key issue was in launching the trusses over the central 50m wide navigation channel that had to be kept clear during construction to give safe access to other users of the bay.

The truss was launched in segments in a synchronised lift with two mobile crane units. This was done at night to minimise disturbance caused by closing the channel.

Permanent works

A mobile gantry crane was positioned on the temporary bridge to lift elements into place. Erection started from the North Abutment starting with the horizontal prefabricated segments (av. 11m long). Then the horizontal deck components were bolted on, and then cross members, hoop members, tension rods, and other loose members were installed working upwards from deck level.

Almost last, but in no way least, the helices and their struts were installed. The individual elements of the helices being welded on the entire span had been erected. These crucial connections were very closely supervised and controlled to ensure the properties of the duplex steel were maintained. Finally a passivation process removed any surface iron compounds which are a potential source of corrosion.

Sequence

The nucleotide sequence, as read going towards Marina Bay Sands, is atctggtcgagctcgggtccactccggattctgtgtgtgtgtgtgtgtcaactgaatga. It does not strongly match any known sequence.

References

Helix Bridge Wikipedia


Similar Topics
×