Puneet Varma (Editor)

Rudivirus

Updated on
Edit
Like
Comment
Share on FacebookTweet on TwitterShare on LinkedInShare on Reddit
Group
  
Group I (dsDNA)

Higher classification
  
Caudovirales

Order
  
Ligamenvirales

Family
  
Rudiviridae

Rank
  
Genus

Similar
  
Fuselloviridae, Corticovirus, Tectivirus, Plasmaviridae, Leviviridae

Rudivirus is a genus of viruses in the order Ligamenvirales; it is the only genus in the family Rudiviridae. These viruses are non-enveloped, stiff-rod-shaped viruses with linear dsDNA genomes, that infect hyperthermophilic archaea of the kingdom Crenarchaeota. There are currently three species in this genus including the type species Sulfolobus islandicus rod-shaped virus 2. The family name derives from the Latin rudis, thin rod, referring to the virion shape.

Contents

Details

  • Main species
  • Sulfolobus islandicus rod-shaped virus 1, SIRV1; genome sequence accession no. AJ414696.
  • Sulfolobus islandicus rod-shaped virus 2, SIRV2; genome sequence accession no. AJ344259.
  • Other species
  • Acidianus rod-shaped virus 1, ARV1; genome sequence accession no. AJ875026.
  • Stygiolobus rod-shaped virus, SRV, genome sequence accession no. FM164764.
  • The two main species, viruses SIRV1 and SIRV2, were produced by colony-cloned Sulfolobus islandicus strains. The two strains were isolated from samples taken in 1994 from different solfataric fields in Iceland, the Kverkfjöll and Hveragerdi, which are separated by a distance of 250 km. These Icelandic solfataric acidic hot springs reach a temperature of 88 °C and pH 2.5. As for its stability in many hosts, SIRV2 is a better candidate for the type species than SIRV1.

    Acidianus rod-shaped virus 1, ARV1, the first member of the family Rudiviridae infecting hyperthermophilic archaea of the genus Acidianus, was isolated from a hot spring in Pozzuoli, Italy in 2005.

    The Stygiolobus rod-shaped virus, SRV, which infects a hyperthermophilic Stygiolobus species, was isolated from a hot spring in the Azores, Portugal in 2008.

    Members of the Rudiviridae share structural and genomic characteristics with viruses from the Lipothrixviridae family, which contains enveloped flexible filamentous viruses. Viruses from the two families have linear dsDNA genomes and share up to nine genes. In addition, the filamentous particles of rudiviruses and lipothrixviruses are built from structurally similar, homologous major capsid proteins. Due to these shared properties viruses from the two families are classified into an order Ligamenvirales.

    Structure

    Virions are non-enveloped, consisting of a tube-like superhelix formed by dsDNA and the major structural protein, with plugs at each end to which three tail fibers are anchored. These tail fibers appear to be involved in adsorption onto the host cell surface and are formed by one of the minor structural proteins.

    Both Sulfolobus islandicus rod-shaped viruses are stiff rods of about 23 nm in width, but differing in length—SIRV1 is about 830 nm and SIRV2 is about 900 nm long. They present a central channel of approx. 6 nm that encapsidates the DNA genome. At each terminus of the rod there is a plug of approx. 48 nm in length and 6 nm in diameter that fills the terminal portion of the cavity, together with three tail fibres of approx. 28 nm in length.

    A three-dimensional reconstruction of the SIRV2 virion at ~4 angstrom resolution has been obtained by cryo–electron microscopy. The structure revealed a previously unknown form of virion organization, in which the alpha-helical major capsid protein of SIRV2 wraps around the DNA, making it inaccessible to solvent. The viral DNA was found to be entirely in the A-form, which suggests a common mechanism with bacterial spores for protecting DNA in the most adverse environments.

    Acidianus rod-shaped virus 1 is 610 nm long and 22 nm wide, also has the three tail fibers protruding at each end and the same central channel encapsidating the genome.

    The Stygiolobus rod-shaped virus displays a similar rod-shaped morphology, sizing 702 nm by 22 nm.

    Genome

    The rudiviral genome is composed of linear dsDNA and ranges from 24 kb (ARV1) to 35 kb (SIRV2). The two strands of the linear genomes are covalently linked and, at both ends of the genome, there are inverted terminal repeats. The Sulfolobus rudiviruses size up to 32.3 kbp for SIRV1 and 35.8 kbp for SIRV2, with inverted terminal repeats of 2029 bp at the ends of the linear genome. The G+C content of both genomes is extremely low, of only 25%, whereas the genome of Sulfolobus solfataricus (the sequenced genome closest to the virus host) hits 37%.

    The genome sequence and composition of ARV1 differs strongly from those of the Sulfolobus rudiviruses. ARV1 has a genome of 24,655 bp, including 1365 bp inverted terminal repeats at both ends.

    SRV shows sufficient genomical differences from the other rudiviruses to warrant its classification as a novel species. Its genome totals 28,096 bp and presents inverted terminal repeats of 1,030 bp.

    Although the sequences of the inverted terminal repeats of the rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends, which may constitute a signal for the Holliday junction resolvase and DNA replication.

    Transcriptional Patterns and Transcription Regulation

    The transcriptional patterns of the rudiviruses SIRV1 and SIRV2 are relatively simple, with few temporal expression differences. In contrast, at least 10% of its genes were predicted to have of different DNA binding motifs in the proteins they code and were assigned to be putative transcriptional regulators. A high proportion of viral genes coding for DNA binding proteins with the ribbon-helix-helix (RHH) DNA binding motifs has been suggested. The abundance of genes coding for proteins belonging to the RHH superfamily present in the genomes of crenarchaea and their viruses could underline the important role of these proteins in host and viral gene transcription regulation under harsh conditions.

    Protein SvtR was the first crenarchaeal RHH regulator characterized in details and also the first viral coded transcriptional regulators within the Archaeal domain. It strongly represses the transcription of the minor structural protein and, to a lesser extent, of its own gene. The structure is very similar to that of bacterial RHH proteins despite the low sequence similarity, such as CopG, a bacterial plasmid copy number control regulator.

    A Sulfolobus islandicus coded transcription activator, Sta1, as also been shown to activate transcription of several viral genes.

    Viral life cycle

    Sulfolobus islandicus rod-shaped virus 2 (SIRV2) is a lytic virus that kills the host cell as a consequence of elaborated mechanisms orchestrated by the virus. Massive degradation of the host chromosomes occurs because of virus infection and virion assembly occurs in the cytoplasm. Virions are released from the host cell through a mechanism that involves the formation of specific cellular structures.

    Potential applications in Nanotechnology

    SIRV2 can act as a template for site-selective and spatially controlled chemical modification. Both the ends and the body of the virus, or the ends only, can be chemically addressed, thus SIRV2 can be regarded as a structurally unique nanobuilding block.

    References

    Rudivirus Wikipedia


    Similar Topics
    ×